©The Author(s) 2021.
World J Gastroenterol. Apr 28, 2021; 27(16): 1770-1784
Published online Apr 28, 2021. doi: 10.3748/wjg.v27.i16.1770
Published online Apr 28, 2021. doi: 10.3748/wjg.v27.i16.1770
Table 1 Primers used for quantitative reverse transcription polymerase chain reaction analysis of gene expression in gastric and duodenal tissue
| Gene | Accession No. | Forward primer | Reverse primer |
| MASP1 | NM_022257.1 | CAACTACATCGGCGGCTACTACTG | GCTGGTGATTGTGCCTGTCCTC |
| A2m | NM_012488.2 | TCATCCAAGTCTGGTTCTTCTC | CCAGAACCATATACTGCGGT |
| CYP2b2 | NM_001198676.1 | GGAAGAACGGATTCAGGAGGAAGC | CTGTGATGCACTGGAAGAGGAAGG |
| UGT2b1 | NM_173295.1 | ATGTCATTCTCGCAGATGCTGTGG | ATAGGAAGGAGGCAGTGGAAGTCC |
Table 2 Top 10 Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed mRNAs in gastric tissue from rats the study groups
| Treatment | KEGG pathway | P value |
| Sham vs PL | Staphylococcus aureus infection | 1.83 × 10-5 |
| Cytokine-cytokine receptor interaction | 2.93 × 10-4 | |
| Renin-angiotensin system | 7.29 × 10-4 | |
| Inflammatory bowel disease | 8.59 × 10-4 | |
| Rheumatoid arthritis | 1.52 × 10-3 | |
| Retinol metabolism | 1.57 × 10-3 | |
| Amoebiasis | 1.59 × 10-3 | |
| Mineral absorption | 1.75 × 10-3 | |
| Hematopoietic cell lineage | 2.35 × 10-3 | |
| Ascorbate and aldarate metabolism | 2.51 × 10-3 | |
| PL vs SL-4 | Complement and coagulation cascades | 2.59 × 10-11 |
| Staphylococcus aureus infection | 5.95 × 10-8 | |
| Cytokine-cytokine receptor interaction | 2.06 × 10-7 | |
| Steroid hormone biosynthesis | 8.49 × 10-6 | |
| Hematopoietic cell lineage | 3.10 × 10-5 | |
| Malaria | 6.08 × 10-5 | |
| Chemical carcinogenesis | 1.22 × 10-4 | |
| Metabolism of xenobiotics by cytochrome P450 | 1.28 × 10-4 | |
| Pertussis | 1.99 × 10-4 | |
| Retinol metabolism | 2.25 × 10-4 |
Table 3 Top 10 Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed mRNAs in duodenal tissue from rats the study groups
| Treatment | KEGG pathway | P value |
| Shame vs PL | Complement and coagulation cascades | 3.93 × 10-9 |
| Staphylococcus aureus infection | 4.53 × 10-9 | |
| Cytokine-cytokine receptor interaction | 6.48 × 10-7 | |
| Hematopoietic cell lineage | 9.84 × 10-6 | |
| Rheumatoid arthritis | 2.78 × 10-5 | |
| Osteoclast differentiation | 4.40 × 10-5 | |
| PI3K-Akt signalling pathway | 2.13 × 10-4 | |
| Tuberculosis | 2.89 × 10-4 | |
| ECM-receptor interaction | 3.02 × 10-4 | |
| Amoebiasis | 3.37 × 10-4 | |
| PL vs SL-4 | Maturity onset diabetes of the young | 2.10 × 10-7 |
| Complement and coagulation cascades | 7.39 × 10-6 | |
| Staphylococcus aureus infection | 7.99 × 10-5 | |
| Regulation of autophagy | 2.26 × 10-3 | |
| Type II diabetes mellitus | 8.47 × 10-3 | |
| Longevity regulating pathway—multiple species | 1.51 × 10-2 | |
| Phototransduction | 2.05 × 10-2 | |
| Mucin type O-Glycan biosynthesis | 2.35 × 10-2 | |
| Porphyrin and chlorophyll metabolism | 3.51 × 10-2 | |
| Longevity regulating pathway | 4.01 × 10-2 |
Table 4 Sequence of major genes involved in two main Kyoto Encyclopedia of Genes and Genomes pathways in gastric and duodenal tissue
| Tissue pathway | Gene symbol | Gene name | Sham vs PL | PL vs SL-4 | GeneBank accession No. |
| Gastric (retinol metabolism) | UGT2b1 | UDP glucuronosyl transferase 2 family, polypeptide B1" | +13.71 | -30.56 | NM_173295 |
| SDR16c5 | Short chain dehydrogenase/reductase family 16C, member 5 | +7.16 | +3.12 | NM_001106634 | |
| RDH7 | Retinol dehydrogenase 7 | +5.89 | -45.38 | NM_133543 | |
| CYP2b2 | Cytochrome P450, family 2, subfamily b, polypeptide 2 | +5.57 | -12.51 | NM_001198676 | |
| CYP4a1 | Cytochrome P450, family 4, subfamily a, polypeptide 1 | +3.93 | -83.27 | NM_175837 | |
| CYP1a1 | Cytochrome P450, family 1, subfamily a, polypeptide 1 | -3.47 | +1.86 | NM_012540 | |
| Duodenal (complement and coagulation cascades) | A2m | Alpha-2-macroglobulin | -20.37 | +33.00 | NM_012488 |
| FGG | Fibrinogen gamma chain | -41.01 | +15.50 | NM_012559 | |
| FGA | Fibrinogen alpha chain | -23.51 | +6.49 | NM_001008724 | |
| MASP1 | Mannan-binding lectin serine peptidase 1 | -11.09 | +3.19 | AY149996 | |
| VSIG4 | V-set and immunoglobulin domain containing 4 | -6.37 | +3.26 | NM_001025004 | |
| CFB | Complement factor B | +3.08 | -5.43 | NM_212466 |
- Citation: Tong S, Wang H, A LS, Bai TN, Gong JH, Jin WJ, Dai LL, Ba GN, Cho SB, Fu MH. Protective effect and mechanisms of action of Mongolian medicine Sulongga-4 on pyloric ligation-induced gastroduodenal ulcer in rats. World J Gastroenterol 2021; 27(16): 1770-1784
- URL: https://www.wjgnet.com/1007-9327/full/v27/i16/1770.htm
- DOI: https://dx.doi.org/10.3748/wjg.v27.i16.1770
