BPG is committed to discovery and dissemination of knowledge
Basic Study
©The Author(s) 2021.
World J Gastroenterol. Apr 28, 2021; 27(16): 1770-1784
Published online Apr 28, 2021. doi: 10.3748/wjg.v27.i16.1770
Table 1 Primers used for quantitative reverse transcription polymerase chain reaction analysis of gene expression in gastric and duodenal tissue
Gene
Accession No.
Forward primer
Reverse primer
MASP1NM_022257.1CAACTACATCGGCGGCTACTACTGGCTGGTGATTGTGCCTGTCCTC
A2mNM_012488.2TCATCCAAGTCTGGTTCTTCTCCCAGAACCATATACTGCGGT
CYP2b2NM_001198676.1GGAAGAACGGATTCAGGAGGAAGCCTGTGATGCACTGGAAGAGGAAGG
UGT2b1NM_173295.1ATGTCATTCTCGCAGATGCTGTGGATAGGAAGGAGGCAGTGGAAGTCC
Table 2 Top 10 Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed mRNAs in gastric tissue from rats the study groups
TreatmentKEGG pathwayP value
Sham vs PLStaphylococcus aureus infection1.83 × 10-5
Cytokine-cytokine receptor interaction 2.93 × 10-4
Renin-angiotensin system7.29 × 10-4
Inflammatory bowel disease8.59 × 10-4
Rheumatoid arthritis1.52 × 10-3
Retinol metabolism1.57 × 10-3
Amoebiasis1.59 × 10-3
Mineral absorption1.75 × 10-3
Hematopoietic cell lineage2.35 × 10-3
Ascorbate and aldarate metabolism 2.51 × 10-3
PL vs SL-4Complement and coagulation cascades2.59 × 10-11
Staphylococcus aureus infection5.95 × 10-8
Cytokine-cytokine receptor interaction2.06 × 10-7
Steroid hormone biosynthesis8.49 × 10-6
Hematopoietic cell lineage3.10 × 10-5
Malaria6.08 × 10-5
Chemical carcinogenesis1.22 × 10-4
Metabolism of xenobiotics by cytochrome P4501.28 × 10-4
Pertussis1.99 × 10-4
Retinol metabolism2.25 × 10-4
Table 3 Top 10 Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed mRNAs in duodenal tissue from rats the study groups
TreatmentKEGG pathwayP value
Shame vs PLComplement and coagulation cascades3.93 × 10-9
Staphylococcus aureus infection4.53 × 10-9
Cytokine-cytokine receptor interaction6.48 × 10-7
Hematopoietic cell lineage9.84 × 10-6
Rheumatoid arthritis2.78 × 10-5
Osteoclast differentiation4.40 × 10-5
PI3K-Akt signalling pathway2.13 × 10-4
Tuberculosis2.89 × 10-4
ECM-receptor interaction3.02 × 10-4
Amoebiasis3.37 × 10-4
PL vs SL-4Maturity onset diabetes of the young2.10 × 10-7
Complement and coagulation cascades7.39 × 10-6
Staphylococcus aureus infection7.99 × 10-5
Regulation of autophagy2.26 × 10-3
Type II diabetes mellitus8.47 × 10-3
Longevity regulating pathway—multiple species1.51 × 10-2
Phototransduction2.05 × 10-2
Mucin type O-Glycan biosynthesis2.35 × 10-2
Porphyrin and chlorophyll metabolism3.51 × 10-2
Longevity regulating pathway4.01 × 10-2
Table 4 Sequence of major genes involved in two main Kyoto Encyclopedia of Genes and Genomes pathways in gastric and duodenal tissue
Tissue pathwayGene symbolGene nameSham vs PLPL vs SL-4GeneBank accession No.
Gastric (retinol metabolism)UGT2b1UDP glucuronosyl transferase 2 family, polypeptide B1"+13.71-30.56NM_173295
SDR16c5Short chain dehydrogenase/reductase family 16C, member 5+7.16+3.12NM_001106634
RDH7Retinol dehydrogenase 7+5.89-45.38NM_133543
CYP2b2Cytochrome P450, family 2, subfamily b, polypeptide 2+5.57-12.51NM_001198676
CYP4a1Cytochrome P450, family 4, subfamily a, polypeptide 1+3.93-83.27NM_175837
CYP1a1Cytochrome P450, family 1, subfamily a, polypeptide 1-3.47+1.86NM_012540
Duodenal (complement and coagulation cascades)A2mAlpha-2-macroglobulin-20.37+33.00NM_012488
FGGFibrinogen gamma chain-41.01+15.50NM_012559
FGAFibrinogen alpha chain-23.51+6.49NM_001008724
MASP1Mannan-binding lectin serine peptidase 1-11.09+3.19AY149996
VSIG4V-set and immunoglobulin domain containing 4-6.37+3.26NM_001025004
CFBComplement factor B+3.08-5.43NM_212466


Write to the Help Desk