Protective effect and mechanisms of action of Mongolian medicine Sulongga-4 on pyloric ligation-induced gastroduodenal ulcer in rats

Table 1 Primers used for quantitative reverse transcription polymerase chain reaction analysis of gene expression in gastric and duodenal tissue

Gene	Accession No.	Forward primer	Reverse primer
MASP1	NM_022257.1	CAACTACATCGGCGGCTACTACTG	GCTGGTGATTGTGCCTGTCCTC
A2m	NM_012488.2	TCATCCAAGTCTGGTTCTTCTC	CCAGAACCATATACTGCGGT
CYP2b2	NM_001198676.1	GGAAGAACGGATTCAGGAGGAAGC	CTGTGATGCACTGGAAGAGGAAGG
UGT2b1	NM_173295.1	ATGTCATTCTCGCAGATGCTGTGG	ATAGGAAGGAGGCAGTGGAAGTCC

Table 2 Top 10 Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed mRNAs in gastric tissue from rats the study groups

Treatment	KEGG pathway	P value
Sham vs PL	Staphylococcus aureus infection	1.83 × 10-5
	Cytokine-cytokine receptor interaction	2.93 × 10-4
	Renin-angiotensin system	7.29 × 10-4
	Inflammatory bowel disease	8.59 × 10-4
	Rheumatoid arthritis	1.52 × 10-3
	Retinol metabolism	1.57 × 10-3
	Amoebiasis	1.59 × 10-3
	Mineral absorption	1.75 × 10-3
	Hematopoietic cell lineage	2.35 × 10-3
	Ascorbate and aldarate metabolism	2.51 × 10-3
PL vs SL-4	Complement and coagulation cascades	2.59 × 10-11
	Staphylococcus aureus infection	5.95 × 10-8
	Cytokine-cytokine receptor interaction	2.06 × 10-7
	Steroid hormone biosynthesis	8.49 × 10-6
	Hematopoietic cell lineage	3.10 × 10-5
	Malaria	6.08 × 10-5
	Chemical carcinogenesis	1.22 × 10-4
	Metabolism of xenobiotics by cytochrome P450	1.28 × 10-4
	Pertussis	1.99 × 10-4
	Retinol metabolism	2.25 × 10-4

KEGG: Kyoto Encyclopedia of Genes and Genomes; PL: Pyloric ligation; Sham: Sham operation; SL-4: Sulongga-4 decoction.

Table 3 Top 10 Kyoto Encyclopedia of Genes and Genomes pathways enriched with differentially expressed mRNAs in duodenal tissue from rats the study groups

Treatment	KEGG pathway	P value
Shame vs PL	Complement and coagulation cascades	3.93 × 10-9
	Staphylococcus aureus infection	4.53 × 10-9
	Cytokine-cytokine receptor interaction	6.48 × 10-7
	Hematopoietic cell lineage	9.84 × 10-6
	Rheumatoid arthritis	2.78 × 10-5
	Osteoclast differentiation	4.40 × 10-5
	PI3K-Akt signalling pathway	2.13 × 10-4
	Tuberculosis	2.89 × 10-4
	ECM-receptor interaction	3.02 × 10-4
	Amoebiasis	3.37 × 10-4
PL vs SL-4	Maturity onset diabetes of the young	2.10 × 10-7
	Complement and coagulation cascades	7.39 × 10-6
	Staphylococcus aureus infection	7.99 × 10-5
	Regulation of autophagy	2.26 × 10-3
	Type II diabetes mellitus	8.47 × 10-3
	Longevity regulating pathway—multiple species	1.51 × 10-2
	Phototransduction	2.05 × 10-2
	Mucin type O-Glycan biosynthesis	2.35 × 10-2
	Porphyrin and chlorophyll metabolism	3.51 × 10-2
	Longevity regulating pathway	4.01 × 10-2

KEGG: Kyoto Encyclopedia of Genes and Genomes; Sham: PL: Pyloric ligation; Sham operation; SL-4: Sulongga-4 decoction.

Table 4 Sequence of major genes involved in two main Kyoto Encyclopedia of Genes and Genomes pathways in gastric and duodenal tissue

Tissue pathway	Gene symbol	Gene name	Sham vs PL	PL vs SL-4	GeneBank accession No.
Gastric (retinol metabolism)	UGT2b1	UDP glucuronosyl transferase 2 family, polypeptide B1"	+13.71	-30.56	NM_173295
	SDR16c5	Short chain dehydrogenase/reductase family 16C, member 5	+7.16	+3.12	NM_001106634
	RDH7	Retinol dehydrogenase 7	+5.89	-45.38	NM_133543
	CYP2b2	Cytochrome P450, family 2, subfamily b, polypeptide 2	+5.57	-12.51	NM_001198676
	CYP4a1	Cytochrome P450, family 4, subfamily a, polypeptide 1	+3.93	-83.27	NM_175837
	CYP1a1	Cytochrome P450, family 1, subfamily a, polypeptide 1	-3.47	+1.86	NM_012540
Duodenal (complement and coagulation cascades)	A2m	Alpha-2-macroglobulin	-20.37	+33.00	NM_012488
	FGG	Fibrinogen gamma chain	-41.01	+15.50	NM_012559
	FGA	Fibrinogen alpha chain	-23.51	+6.49	NM_001008724
	MASP1	Mannan-binding lectin serine peptidase 1	-11.09	+3.19	AY149996
	VSIG4	V-set and immunoglobulin domain containing 4	-6.37	+3.26	NM_001025004
	CFB	Complement factor B	+3.08	-5.43	NM_212466

Genes involved in the retinol metabolism pathway in gastric tissue and in the complement and coagulation cascade pathways in duodenal tissue with > 2-fold change associated with different experimental treatments were determined by microarray analysis. Fold-induction was calculated as the normalized intensity in the study groups. Positive and negative numbers represent up- and downregulated gene expression. PL: Pyloric ligation; Sham: Sham operation; SL-4: Sulongga-4 decoction.