©The Author(s) 2020.
World J Gastroenterol. Aug 28, 2020; 26(32): 4817-4832
Published online Aug 28, 2020. doi: 10.3748/wjg.v26.i32.4817
Published online Aug 28, 2020. doi: 10.3748/wjg.v26.i32.4817
Table 1 PCR primers
| Primer | Primer sequence (59R39) | Ref. |
| cagA-F | GATAACAGGCAAGCTTTTGAGG1 | [19,20] |
| cagA-R | CTGCAAAAGATTGTTTGGCAGA1 | |
| cagA28F | TTCTCAAAGGAGCAATTGGC2 | [21] |
| cagA-P1C | GTCCTGCTTTCTTTTTATTAACTTKAGC2 | |
| cagA-P2CG | TTTAGCAACTTGAGCGTAAATGGG2 | |
| cagA-P2TA | TTTAGCAACTTGAGTATAAATGGG2 | |
| cagA-P3E | ATCAATTGTAGCGTAAATGGG2 | |
| “cag empty PCR” | GCTTGCTTGTATTGGCCTTG / GCATGCACATTCCCTAAAGT3 | [22] |
Table 2 Comparison of human leukocyte antigen alleles predisposing susceptibility and resistance to gastric cancer/duodenal ulcer in patient and control groups, n (%)
| HLA alleles | Patient groupGC + DU, H. pylori (+) (n = 94, alleles = 198) | Control groupNUD + Asymptomatic, H. pylori (+) (n = 86, alleles = 172) | OR | 95%CI | P value | |
| Minimum | Maximum | |||||
| HLAs increasing susceptibility to GC/DU | ||||||
| HLA-A*02 | 52 (27.6) | 38 (22) | 1.34 | 0.833 | 2.182 | 0.2239 |
| HLA-B*35 | 40 (21.3) | 26 (15.1) | 1.51 | 0.880 | 2.615 | 0.1329 |
| HLA-DRB1*13 | 36 (19) | 24 (14) | 1.46 | 0.831 | 2.567 | 0.1880 |
| HLA-DQA1*01 | 76 (40) | 30 (17.4) | 3.21 | 1.968 | 5.242 | 0.0001 |
| HLA-DQB1*06 | 52 (27.6) | 20 (11.6) | 2.90 | 1.652 | 5.139 | 0.0002 |
| HLAs making resistant to GC/DU | ||||||
| HLA-A*03 | 14 (7.4) | 20 (11.6) | 0.61 | 0.298 | 1.252 | 0.1787 |
| HLA-B*50 | 0 (0) | 10 (5.8) | 0.08 | 0.010 | 0.680 | 0.0201 |
| HLA-DRB1*04 | 16 (8.5) | 24 (14) | 0.57 | 0.293 | 1.120 | 0.1038 |
| HLA-DQA1*05 | 28 (14.9) | 54 (31.4) | 0.38 | 0.228 | 0.639 | 0.0003 |
| HLA-DQB1*03 | 42 (23) | 64 (37.2) | 0.48 | 0.305 | 0.770 | 0.0022 |
Table 3 The comparison of human leukocyte antigen alleles which increase or decrease the gastric cancer risk in gastric cancer subgroup cases in terms of CagA+ (≥ 2) EPIYA-C, n (%)
| GC (≥ 2) EPIYA-C (n = 26, alleles = 52) | GC (< 2) EPIYA-C (n = 18, alleles = 36) | OR | 95%CI | P value | |||
| Minimum | Maximum | ||||||
| HLA-A*02 | 12 (23) | 10 (27) | 0.78 | 0.29 | 2.06 | 0.6170 | |
| HLA-B*35 | 12 (23) | 10 (27) | 0.78 | 0.29 | 2.06 | 0.6170 | |
| HLA-DRB1*13 | 12 (23) | 12 (33) | 0.60 | 0.23 | 1.54 | 0.2903 | |
| HLA-DQA1*01 | 24 (46) | 16 (44) | 1.07 | 0.45 | 2.51 | 0.8742 | |
| HLA-DQB1*06 | 12 (23) | 16 (44) | 0.37 | 1.14 | 2.90 | 0.0369 | |
Table 4 The comparison of human leukocyte antigen alleles which increase or decrease the duodenal ulcer risk in duodenal ulcer subgroup in terms of CagA+(≥ 2) EPIYA-C, n (%)
| DU (≥ 2) EPIYA-C (n = 14, alleles = 28) | DU (< 2) EPIYA-C (n = 36, alleles = 72) | ORc | 95%CI | P value | |||
| Minimum | Maximum | ||||||
| HLA-A*02 | 10 (36) | 20 (27) | 1.44 | 0.53 | 3.62 | 0.4380 | |
| HLA-B*35 | 4 (14) | 14 (19) | 0.80 | 0.24 | 0.680 | 0.0201 | |
| HLA-DRB1*13 | 6 (21) | 6 (8) | 3 | 0.87 | 10.26 | 0.0801 | |
| HLA-DQA1*01 | 10 (36) | 26 (36) | 0.9 | 0.39 | 2.44 | 0.9704 | |
| HLA-DQB1*06 | 8 (28) | 16 (22) | 1.4 | 0.52 | 3.75 | 0.5340 | |
Table 5 The comparison of human leukocyte antigen alleles which increase or decrease the gastric cancer/duodenal ulcer risk in gastric cancer and duodenal ulcer subgroups in terms of CagA+(≥ 2) EPIYA-C, n (%)
| GC(≥ 2) EPIYA-C (n = 26, alleles=52) | DU(≥ 2) EPIYA-C (n = 14, alleles=28) | OR | 95%CI | P value | |||
| Minimum | Maximum | ||||||
| HLA-A*02 | 12 (23) | 10 (36) | 0.54 | 0.19 | 1.47 | 0.2302 | |
| HLA-B*35 | 12 (23) | 4 (14) | 1.80 | 0.52 | 6.21 | 0.3527 | |
| HLA-DRB1*13 | 12 (23) | 6 (21) | 1.10 | 0.36 | 3.83 | 0.8663 | |
| HLA-DQA1*01 | 24 (46) | 10 (36) | 1.54 | 0.59 | 3.97 | 0.3689 | |
| HLA-DRB1*06 | 12 (23) | 8 (28) | 0.75 | 0.26 | 2.12 | 0.5889 | |
Table 6 Results of logistic regressions analysis according to the variables in patient group (gastric cancer and duodenal ulcer cases)
| P value | OR | 95%CI | ||
| Lower | Upper | |||
| HLA-DQA1*01 | 0.004 | 1.848 | 1.215 | 2.811 |
| HLA-DQA1*05 | 0.050 | |||
| HLA-DQB1*03 | 0.061 | |||
| HLA-DQB1*06 | 0.009 | 1.821 | 1.163 | 2.850 |
| HLA-A*02 | 0.040 | 1.579 | 1.021 | 2.442 |
| HLA-A*25 | 0.999 | |||
Table 7 Frequency of detected human leukocyte antigen class I alleles and the class II alleles in patients with cancer and ulcer and in the control groups, n (%)
| HLA-A | Allele frequency | HLA-B | Allele frequency | HLA-DRB1 | Allele frequency | HLA-DQA1 | Allele frequency | HLA-DQB1 | Allele frequency | |||||
| Alleles | Cases (n = 94) | Control (n = 86) | Alleles | Cases (n = 94) | Control (n = 86) | Alleles | Cases (n = 94) | Control (n = 86) | Alleles | Cases (n = 94) | Control (n = 86) | Alleles | Cases (n = 94) | Control (n = 86) |
| 01 | 22 (11.4) | 24 (13.9) | 07 | 18 (9.5) | 22 (12.8) | 01 | 14 (7.4) | 8 (4.6) | 01 | 76 (40) | 30 (17.4) | 02 | 20 (10.6) | 26 (15.1) |
| 02 | 52 (27.6) | 38 (22) | 08 | 6 (3.2) | 6 (3.5) | 03 | 10 (5.3) | 10 (5.8) | 02 | 20 (10.6) | 20 (11.6) | 03 | 42 (23) | 64 (37.2) |
| 03 | 14 (7.4) | 20 (11.6) | 13 | 6 (3.2) | 4 (2.3) | 04 | 16 (8.5) | 22 (12.7) | 03 | 12 (6.4) | 22 (12.8) | 04 | 26 (13.8) | 28 (16.2) |
| 11 | 18 (9.5) | 18 (10.4) | 14 | 6 (3.2) | 4 (2.3) | 07 | 10 (5.3) | 20 (11.6) | 04 | 16 (8.5) | 20 (11.6) | 05 | 48 (25.5) | 34 (19.8) |
| 23 | 10 (5.3) | 4 (2.3) | 15 | 2 (1) | 6 (3.5) | 08 | 4 (2.1) | 6 (3.5) | 05 | 28 (14.9) | 54 (31.4) | 06 | 52 (27.6) | 20 (11.6) |
| 24 | 26 (13.8) | 24 (13.9) | 18 | 10 (5.3) | 10 (5.8) | 10 | 6 (3.2) | 4 (2.3) | 06 | 36 (19.1) | 26 (15.1) | |||
| 25 | 0 (0) | 2 (1.1) | 27 | 6 (3.2) | 4 (2.3) | 11 | 34 (18) | 42 (24.4) | ||||||
| 26 | 4 (2.1) | 4 (2.3) | 35 | 40 (21.3) | 26 (15.1) | 12 | 6 (3.2) | 2 (1.2) | ||||||
| 29 | 8 (4.2) | 8 (4.6) | 37 | 4 (2.1) | 0 (0) | 13 | 36 (19) | 24 (14) | ||||||
| 30 | 4 (2.1) | 6 (3.4) | 38 | 8 (4.2) | 2 (1.2) | 14 | 18 (9.5) | 8 (4.6) | ||||||
| 31 | 2 (1) | 4 (2.3) | 39 | 0 (0) | 4 (2.3) | 15 | 28 (14.9) | 22 (12.8) | ||||||
| 32 | 16 (8.5) | 10 (5.8) | 40 | 6 (3.2) | 6 (3.5) | 16 | 6 (3.2) | 4 (2.3) | ||||||
| 33 | 6 (3.1) | 4 (2.3) | 41 | 4 (2.1) | 2 (1.2) | |||||||||
| 68 | 4 (2.1) | 6 (3.4) | 44 | 8 (4.2) | 14 (8.1) | |||||||||
| 69 | 2 (1) | 0 (0) | 45 | 0 (0) | 2 (1.2) | |||||||||
| 48 | 2 (1) | 2 (1.2) | ||||||||||||
| 49 | 6 (3.2) | 4 (2.3) | ||||||||||||
| 50 | 0 (0) | 10 (5.8) | ||||||||||||
| 51 | 24 (12) | 30 (17.4) | ||||||||||||
| 52 | 14 (7.4) | 2 (1.2) | ||||||||||||
| 53 | 0 (0) | 2 (1.2) | ||||||||||||
| 54 | 2 (1) | 0 (0) | ||||||||||||
| 55 | 6 (3.2) | 8 (4.6) | ||||||||||||
| 57 | 2 (1) | 2 (1.2) | ||||||||||||
| 58 | 8 (4.2) | 0 (0) | ||||||||||||
| 78 | 0 (0) | 0 (0) | ||||||||||||
Table 8 The distribution of EPIYA motifs for study and control groups, n (%)
| EPIYA-C repeat patterns | Patient group | Control group | Total (n = 140) | ||||||
| Gastric cancer | Duodenal ulcer | Non-ulcer dyspepsia | Individuals with normal gastrointestinal system | ||||||
| ABC | 12 | (27.2) | 34 | (68) | 28 | (93.3) | 16 | (100) | 90 |
| AC | 2 | (4.5) | 2 | (4) | - | - | 4 | ||
| BC | 2 | (4.5) | - | - | - | 2 | |||
| ABCC | 16 | (36.4) | 8 | (16) | - | - | 24 | ||
| BCC | 2 | (4.6) | 2 | (4) | 2 | (6.7) | - | 6 | |
| ACCC | - | - | - | - | - | ||||
| ABCC | 8 | (18.2) | 4 | (8) | - | - | 12 | ||
| AB | 2 | (4.6) | - | - | - | 2 | |||
| Total | 44 | (100) | 50 | (100) | 30 | (100) | 16 | (100) | 140 |
- Citation: Saribas S, Demiryas S, Yilmaz E, Uysal O, Kepil N, Demirci M, Caliskan R, Dinc HO, Akkus S, Gareayaghi N, Kirmusaoglu S, Ozbey D, Tokman HB, Koksal SS, Tasci I, Kocazeybek B. Association between human leukocyte antigen gene polymorphisms and multiple EPIYA-C repeats in gastrointestinal disorders. World J Gastroenterol 2020; 26(32): 4817-4832
- URL: https://www.wjgnet.com/1007-9327/full/v26/i32/4817.htm
- DOI: https://dx.doi.org/10.3748/wjg.v26.i32.4817