Mutation analysis of related genes in hamartoma polyp tissue of Peutz-Jeghers syndrome

Table 1 Clinicopathological data of enrolled patients with Peutz-Jeghers syndrome

Case No.	Onset time of pigment spots (yr)	Gender	Family history or not (detail)	Load of gastric polyps	Maximum diameter of gastric polyps (mm)	Load of duodenal and small intestinal polyps	Maximum diameter of duodenal and small intestinal polyps (mm)	Load of colorectal polyps	Maximum diameter of colorectal polyps (mm)	Number of hospitalization times	Number of operation times	Number of intervention times
1	0	Male	Yes (Father)	0	0	1-10	30	Unknown	Unknown	1	1	3
2	0	Male	No	1-10	10	31-40	80	11-20	70	3	1	4
3	7	Female	Yes (Father)	1-10	6	21-30	25	Unknown	Unknown	1	1	4
4	2	Male	No	11-20	17	1-10	25	1-10	40	1	1	4
5	10	Male	Yes (Son)	1-10	5	51-60	50	41-50	25	5	3	12
6	1	Male	Yes (Mother)	1-10	5	1-10	35	1-10	35	2	1	3
7	1	Male	No	1-10	23	1-10	50	Unknown	Unknown	1	0	2
8	1	Male	Yes (Grandmother and mother)	0	0	Unknown	Unknown	51-60	70	1	4	20
9	7	Male	Yes (Father)	0	0	11-20	60	21-30	12	1	1	9
10	13	Female	No	0	0	1-10	40	1-10	10	3	4	9
11	2	Male	No	1-10	8	1-10	25	1-10	6	2	0	4
12	0	Female	No	1-10	15	41-50	60	11-20	50	2	4	9
13	5	Female	Yes (Father and brother)	21-30	15	41-50	60	21-30	60	4	2	9
14	18	Female	No	21-30	5	11-20	30	1-10	6	2	1	5
15	0.8	Female	Yes (Father)	1-10	6	1-10	6	0	0	2	0	4
16	2	Male	Yes (Father)	21-30	20	31-40	45	51-60	45	2	7	21
17	4	Female	Yes (Son)	Unknown	Unknown	21-30	30	1-10	30	1	1	5
18	0	Male	No	1-10	15	Unknown	Unknown	1-10	20	1	0	2
19	5	Female	No	0	0	11-20	20	Unknown	Unknown	1	2	7
20	4	Female	Yes (Sister)	1-10	50	21-30	50	Unknown	Unknown	1	0	7

Table 2 Mutation status of LKB1/STK11 gene

Case No.	Allele	Mutation type	Exon/intron	Amino acid change	Base change	New mutation
1	Heterozygosis	Missense	4	p.L167R	c.500T>G	No
2	Heterozygosis	Nonsense	1	p.K84*	c.250A>T	No
3	Heterozygosis	Frameshift deletion	5	p.A241Vfs*46	c.722delC	Yes
4	Homozygous	Frameshift insertion	3	p.Q152Pfs*11	c.454_455insC	Yes
5	Heterozygosis	Frameshift insertion	1	p.Y49Afs*4	c.144_145insGCAAG	Yes
6	Heterozygosis	Missense	5	p.S240W	c.719C>G	No
7	Heterozygosis	Frameshift deletion	1	p.K82Rfs*14	c.243delG	Yes
8	Heterozygosis	Cleavage site	5-61	/	c.734+1G>A	Yes
10	Heterozygosis	Cleavage site	3-41	/	c.464+1G>T	Yes
13	Homozygous	Frameshift deletion	3	p.E145Gfs*10	c.426_448delCGTGCCGGAGAAGCGTTTCCCAG	No
14	Heterozygosis	Nonsense	1	p.K84*	c.250A>T	No
16	Heterozygosis	Frameshift insertion	1	p.Y49Afs*4	c.144_145insGCAAG	No
17	Heterozygosis	Cleavage site	4-51	/	c.598-1G>A	Yes
18	Heterozygosis	Nonsense	1	p.Y49*	c.147C>G	No
19	Heterozygosis	Frameshift deletion	2	p.K122Afs*40	c.363_364delGA	Yes
20	Homozygosis	Cleavage site	3-41	/	c.464+1G>A	No

¹Mutation is located in the intron.

Table 3 Prediction of protein function and amino acid evolution conservation of LKB1/STK11

Case No.	Polyphen-2		Mutation taster		FATHMM		M-CAP		GERP++		phyloP
	Score	Prediction	Score	Prediction	Score	Prediction	Score	Prediction	Score	Prediction	Score	Prediction
1	1	Probably damaging	1	Pathogenic	-2.5	Damaging	0.591	Damaging	5.6	Conserved	7.91	Conserved
2	/	/	1	Pathogenic	/	/	/	/	3.9	Conserved	8.998	Conserved
3	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
4	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
5	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
6	0.993	Probably damaging	1	Pathogenic	-2.79	Damaging	0.704	Damaging	5.6	Conserved	7.799	Conserved
7	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
8	/	/	/	/	/	/	/	/	/	/	/	/
10	/	/	/	/	/	/	/	/	/	/	/	/
13	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
14	/	/	1	Pathogenic	/	/	/	/	3.9	Conserved	8.998	Conserved
16	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
17	/	/	/	/	/	/	/	/	/	/	/	/
18	/	/	1	Pathogenic	/	/	/	/	3.9	Conserved	3.875	Conserved
19	/	/	1	Pathogenic	/	/	/	/	/	/	/	/
20	/	/	/	/	/	/	/	/	/	/	/	/

Case No. 8, 10, 17, and 20 are cleavage site mutations.

Table 4 Mutation of other 13 genes except LKB1/STK11 gene

Case No.	Gene	MMR	Type of mutation	Amino acid change	Base change	New mutation
3	MUTYH	No	Missense	p.Ala373Val	c.1118C>T	No
	MLH1	Yes	Missense	p.Val384Asp	c.1151T>A	No
	PMS2	Yes	Missense	p.Thr511Met	c.1532C>T	No
4	MSH6	Yes	Missense	p.Ala1230Gly	c.3689C>G	Yes
	MLH1	Yes	Missense	p.Val384Asp	c.1151T>A	No
	PMS2	Yes	Missense	p.Thr511Met	c.1532C>T	No
7	MLH3	Yes	Non-synonymous SNV	p.Asp1081His	c.3241G>C	No
	AXIN2	No	Non-synonymous SNV	p.Ser738Phe	c.2213C>T	No
9	MSH6	Yes	Missense	p.Glu1163Val	c.3488A>T	No
	APC	No	Missense	p.Met2221Thr	c.6662T>C	No
10	MSH2	Yes	Missense	p.Ile169Val	c.505A>G	No
	MSH6	Yes	Intron insertion	/	c.4001+13C>CTTAC	Yes
	APC	No	Missense	p.Ala2778Ser	c.8332G>T	No
14	MSH2	Yes	Missense	p.Val89Ala	c.266T>C	No
	MSH2	Yes	Cleavage site	/	c.792+1G>A	Yes
	PMS1	Yes	Nonsense	p.Gln16Ter	c.46C>T	Yes
	PMS1	Yes	Missense	p.Val308Ile	c.922G>A	Yes
15	PTEN	No	Missense in 5 'untranslated region (UTR)	p.Gln171Glu	c.511C>G	No
19	MSH2	Yes	Missense	p.Leu390Phe	c.1168C>T	No
20	MLH1	Yes	Missense	p.Arg217Cys	c.649C>T	No

Table 5 Prediction of protein function changes caused by MSH6 and other gene mutations

Case No.	Gene	Polyphen-2_HDIV		Mutation Taster		FATHMM		M-CAP
		Score	prediction	Score	Prediction	Score	Prediction	Score	Prediction
3	MUTYH	0.069	Benign	1	Pathogenic	-2.41	Damaging	0.084	Damaging
3	MLH1	1	Probably_damaging	1	Pathogenic	-2.66	Damaging	/	/
3	PMS2	0.03	Benign	1	Polymorphism	1.06	Tolerable	/	/
4	MSH6	1	Probably_damaging	1	Pathogenic	-2.52	Damaging	0.292	Damaging
4	MLH1	1	Probably_damaging	1	Pathogenic	-2.66	Damaging	/	/
4	PMS2	0.239	Benign	1	Polymorphism	1.06	Tolerable	/	/
7	MLH3	1	Probably_damaging	1	Pathogenic	-2.37	Damaging	0.137	Damaging
7	AXIN2	0.121	Benign	0.997	Polymorphism	-0.25	Tolerable	/	/
9	MSH6	0.67	Probably_damaging	1	Pathogenic	-2.12	Damaging	/	/
9	APC	0.156	Benign	0.737	Pathogenic	-2.47	Damaging	0.046	Damaging
10	MSH2	0	Benign	1	Polymorphism	-2.29	Damaging	0.028	Damaging
10	MSH6	/	/	/	/	/	/	/	/
10	APC	1	Probably_damaging	1	Pathogenic	-1.53	Damaging	0.033	Damaging
14	MSH2	0.042	Benign	1	Pathogenic	-2.47	Damaging	0.075	Damaging
14	MSH2	/	/	/	/	/	/	/	/
14	PMS1	/	/	1	Pathogenic	/	/	/	/
14	PMS1	0.329	Benign	0.996	Pathogenic	-1.34	Tolerable	0.03	Damaging
15	PTEN	0.956	Probably_damaging	0.999	Pathogenic	/	/	/	/
19	MSH2	0.148	Benign	1	Pathogenic	-3.07	Damaging	/	/
20	MLH1	1	Probably_damaging	1	Pathogenic	-1.91	Damaging	0.247	Damaging

Table 6 Prediction of amino acid evolutionary conservation due to mutations in MSH6 and other genes

Case No.	Gene	GERP++		phyloP
		Score	Prediction	Score	Prediction
3	MUTYH	5.67	Conserved	6.955	Conserved
3	MLH1	5.67	Conserved	7.336	Conserved
3	PMS2	-3.23	Nonconserved	-0.25	Nonconserved
4	MSH6	5.5	Conserved	7.481	Conserved
4	MLH1	5.67	Conserved	7.336	Conserved
4	PMS2	-3.23	Nonconserved	-0.25	Nonconserved
7	MLH3	4.6	Conserved	5.502	Conserved
7	AXIN2	2.07	Conserved	2.225	Conserved
9	MSH6	5.23	Conserved	8.923	Conserved
9	APC	6.02	Conserved	3.925	Conserved
10	MSH2	-1.25	Nonconserved	1.857	Nonconserved
10	MSH6	/	/	/	/
10	APC	5.92	Conserved	8.947	Conserved
14	MSH2	3.94	Conserved	3.331	Conserved
14	MSH2	/	/	/	/
14	PMS1	4.99	Conserved	7.805	Conserved
14	PMS1	2.11	Conserved	4.333	Conserved
15	PTEN	/	/	/	/
19	MSH2	4.62	Conserved	1.611	Nonconserved
20	MLH1	5.76	Conserved	2.993	Conserved

Table 7 Relationship between gene mutation and clinical pathological parameters

Mutation	Result	Load of gastric polyps	Maximum diameter of gastric polyps (mm)	Load of duodenal and small intestinal polyps	Maximum diameter of duodenal and small intestinal polyps (mm)	Load of Colorectal polyps	Maximum diameter of colorectal polyps (mm)	Number of hospitalization times	Number of operation times	Number of intervention times
LKB1/STK11 mutations	U value	28.000	30.000	35.500	26.000	20.500	32.000	36.000	49.000	28.500
	P value	0.885	1.000	0.442	0.878	0.734	0.048	0.750	0.122	0.750
LKB1/STK11 truncating mutation	U value	62.500	69.000	49.500	47.000	23.500	35.500	56.000	40.500	35.500
	P value	0.156	0.053	0.436	0.605	0.613	0.397	0.684	0.481	0.280
Other gene mutations	U value	47.500	42.500	39.000	36.000	22.000	19.500	38.000	46.000	41.500
	P value	0.842	0.842	0.965	0.762	0.607	0.388	0.412	0.824	0.552