©The Author(s) 2019.
World J Gastroenterol. Aug 21, 2019; 25(31): 4481-4492
Published online Aug 21, 2019. doi: 10.3748/wjg.v25.i31.4481
Published online Aug 21, 2019. doi: 10.3748/wjg.v25.i31.4481
Table 1 Primers for polymerase chain reaction
| Wild type gene | Primers, 5'-3' | Annealing temperature (°C) |
| NOD2 (2104C) R702W | CCAGACATCTGAGAAGGCCCTGCTC | 65 |
| rs2066844 | GGCGCCAGGCCTGTGCCCGCTGGTG | |
| NOD2 (2722G) | CTCTTTTGGCCTTTTCAGATTCTGG | 52 |
| rs2066845 | GCAACAGAGTGGGTGACGAGGGGGC | |
| NOD2 (3020T) 3020insC | GGGGCAGAAGCCCTCCTGCAGGCCC | 54 |
| rs2066847 | TTGAAAGGAATGACACCATCCTGGA |
Table 2 Baseline characteristics
| Variable | n = 57 |
| Male, n (%) | 30 (52.6) |
| Age at start of treatment (yr), median (range) | 43.0 (21-68) |
| Montreal classification of CD: | |
| Age, n (A1:A2:A3) | 4:40:13 |
| Location, n (L1:L2:L3:L4) | 18:9:30:4 |
| Behaviour, n (B1:B2:B3), n = 56 | 17:16:23 |
| Prior CD-related intestinal resection, n (%) | 36 (63.2) |
| First degree relative(s) with IBD, n (%), n = 49 | 8 (14.0) |
| Disease duration at baseline (yr), median (range) | 43 (21-68) |
| Presence of at least one extraintestinal manifestation, n (%) | 30 (52.6) |
| Active cigarette smoking, n (%) | 17 (29.8) |
| BMI (kg/m²), mean ± SD (range), n = 56 | 24.7 ± 5.1 (17.9-40.7) |
| History of anti-TNF-α treatment, n (%) | 54 (94.7) |
| History of anti-integrin treatment, n (%) | 16 (28.1) |
| History of immunomodulator treatment, n (%) | 47 (82.5) |
| History of total hospitalisations within 12 months from baseline, n (%) | 14 (24.6) |
| History of CD-related hospitalisations within 12 mo from baseline, n (%) | 12 (21.1) |
| HBI, mean ± SD (range), n = 51 | 6.6 ± 5.1 (0-24) |
| Prior exposure to | |
| 0 biologics, n (%) | 3 (5.3) |
| 1 biologic, n (%) | 14 (24.6) |
| 2 biologics, n (%) | 27 (47.4) |
| 3 biologics, n (%) | 13 (22.8) |
| Endoscopic, MRI and ultrasound findings at 0-12 weeks to baseline | |
| Ulcers in colonoscopy, n (%), n = 25 | 21 (84.0) |
| Inflammation in MRI, n (%), n = 21 | 20 (95.2) |
| Ultrasound wall thickening > 3 mm, n (%), n = 22 | 19 (79.2) |
| Reason for starting ustekinumab therapy | |
| Clinical disease activity, n (%) | 34 (59.6) |
| Imaging (MRI, ultrasound, endoscopy results), n (%) | 17 (29.8) |
| High FC concentration, n (%) | 2 (3.5) |
| Loss of effect of prior therapy, n (%) | 2 (3.5) |
| Intolerance of prior therapy, n (%) | 2 (3.5) |
| Concomitant medications at baseline | |
| Steroids (including budesonide), n (%) | 20 (35.1) |
| Immunomodulators, n (%) | 3 (5.3) |
| NOD2 genotyping | |
| NOD2 rs2066844, n (CC:TT:CT), n = 42 | 34:0:8 |
| NOD2 rs2066845, n (CC:GG:CG), n = 42 | 1:34:7 |
| NOD2 rs2066847, n (--:CC:C-), n = 42 | 35:0:7 |
| Biochemical parameters at baseline | |
| Plasma CRP concentration (mg/L), median (range), n = 56 | 8.0 (1.0-82.4) |
| WCC, (/nL), median (range), n = 56 | 9.2 (4.0-19.1) |
| Haemoglobin concentration (g/dL), mean ± SD (range), n = 56 | 13.33 ± 1.6 (8.8-16.5) |
| PLT count (/nL), mean ± SD (range), n = 56 | 329.8 ± 132.3 (146-845) |
| Plasma albumin concentration (g/L), mean ± SD (range), n = 54 | 43.1 ± 3.5 (33.2-49.0) |
| Plasma ferritin concentration (µg/L), median (range), n = 40 | 83.0 (4-591) |
| Transferrin saturation (%), mean ± SD (range), n = 36 | 18.2 ± 13.2 (2-58) |
| FC concentration (µg/g), median (range), n = 24 | 351.2 (30-1800) |
Table 3 Comparison of baseline characteristics between the subgroups of patients with steroid-free clinical response versus non-responders to ustekinumab therapy
| Parameter | Steroid-free clinical remission/response | Nonresponse | P value |
| n = 57 (%) | 26 (45.6) | 31 (54.4) | |
| Male, n (%) | 10 (38.5) | 20 (64.5) | 0.051 |
| Age at baseline (yr), median (range) | 41.5 (22–68) | 44 (21–68) | 0.812 |
| Montreal classification of CD | |||
| Age, n (A1:A2:A3) | 2:17:7 | 2:23:6 | 0.761 |
| Location, n (L1:L2:L3) | 8:4:14 | 10:5:16 | 0.991 |
| Location L4, n (%) | 1 (3.8) | 3 (9.7) | 0.621 |
| Behaviour, n (B1:B2:B3), n = 56 | 8:6:11 | 9:10:12 | 0.791 |
| Prior CD-related intestinal resections, n (%) | 17 (65.4) | 19 (61.3) | 0.751 |
| First degree relative(s) with IBD, n (%), n = 49 | 4 (15.4) | 4 (17.4) | 1.001 |
| Disease duration at baseline (yr), median (range) | 10 (1-32) | 14 (0-40) | 0.432 |
| Presence of at least one extraintestinal manifestation, n (%) | 9 (34.6) | 21 (67.7) | 0.011 |
| Active cigarette smoking, n (%) | 8 (30.1) | 9 (29.0) | 0.891 |
| BMI (kg/m²), mean ± SD (range), n = 56 | 25.1 ± 5.3 (18.0–40.7) (n = 26) | 24.3 ± 5.0 (17.9–39.7) (n = 30) | 0.442 |
| History of anti-TNF-α treatment, n (%) | 25 (94.7) | 29 (93.5) | 0.661 |
| History of anti-integrin treatment, n (%) | 7 (26.9) | 9 (29.0) | 0.861 |
| History of immunomodulator treatment, n (%) | 22 (84.6) | 25 (80.6) | 0.691 |
| History of total hospitalisations within 12 months from baseline, n (%) | 4 (15.4) | 10 (32.3) | 0.221 |
| History of CD-related hospitalisations within 12 mo from baseline, n (%) | 3 (11.5) | 9 (29.0) | 0.191 |
| HBI at baseline, mean ± SD (range), n = 51 | 4.7 ± 4.3 (0-14) (n = 23) | 8.1 ± 5.3 (1-24) (n = 28) | 0.012 |
| Prior exposure to | 0.961 | ||
| 0 biologics, n (%) | 1 (3.8) | 2 (6.5) | |
| 1 biologic, n (%) | 6 (23.1) | 8 (25.8) | |
| 2 biologics, n (%) | 13 (50.0) | 14 (45.2) | |
| 3 biologics, n (%) | 6 (23.1) | 7 (22.6) | |
| Concomitant medication at baseline | |||
| Steroids (including budesonide), n (%) | 4 (15.4) | 16 (51.6) | 0.0041 |
| Immunomodulators, n (%) | 2 (7.7) | 1 (3.2) | 0.451 |
| NOD2 genotyping | |||
| NOD2 rs2066844; n = 42 (CC:TT:CT) | 15:0:4 | 19:0:4 | 0.761 |
| NOD2 rs2066845, n = 42 (CC:GG:CG) | 1:16:2 | 0:18:5 | 0.361 |
| NOD2 rs2066847, n = 42 (--:CC:C-) | 17:0:2 | 18:0:5 | 0.331 |
| Biochemical parameters at baseline | |||
| Plasma CRP concentration (mg/L), median (range), n=56 | 7.8 (1.0-57.1) n = 26 | 8.9 (1.0-82.4) n = 30 | 0.642 |
| WCC (/nL), median (range), n = 56 | 9.0 (4.0-15.8) n = 26 | 9.2 (4.9-19.1) n = 30 | 0.342 |
| Haemoglobin concentration (g/dL), mean ± SD (range), n = 56 | 13.3 ± 1.8 (8.8-16.5) n = 26 | 13.4 ± 1.5 (10.5-16.1) n = 30 | 0.892 |
| PLT count (/nL), mean ± SD (range), n = 56 | 322 ± 65.0 (208-431) n = 26 | 337 ± 171.6 (146-845) n = 30 | 0.262 |
| Plasma albumin concentration (g/L), mean ± SD (range), n = 54 | 42.8 ± 3.7 (33.2-49.0) n = 25 | 43.3 ± 3.4 (36.2-49.0) n = 29 | 0.522 |
| Plasma ferritin concentration (µg/L), median (range), n = 40 | 69.5 (4.0-428.0) n = 18 | 134.5 (9.0-591.0) n = 22 | 0.142 |
| Transferrin saturation (%), mean ± SD (range), n = 36 | 15.4 ± 12.4 (2.0-45.0) n = 16 | 20.4 ± 13.7 (6.0-58.0) n = 20 | 0.192 |
| FC concentration (µg/g), median (range), n = 24 | 451 (30-1800) n = 8 | 302 (74-1800) n = 16 | 0.882 |
Table 4 Characteristics entering the multivariable logistic regression model
| Parameter | OR | 95%CI | P value |
| Male sex | 0.112 | (0.021; 0.605) | 0.011 |
| Extraintestinal manifestations | 0.119 | (0.022; 0.636) | 0.013 |
| HBI at baseline | 0.853 | (0.718; 1.014) | 0.071 |
| Use of steroids (including budesonide) at baseline | 0.071 | (0.011; 0.464) | 0.006 |
Table 5 Comparison between parameters determined at 24 ± 6 wk from start of ustekinumab therapy between steroid-free clinical responders and non-responders
| Steroid-free clinical remission or response | Nonresponse | P value | |
| n = 48 (%) | 26 (45.6) | 22 (38.6) | |
| HBI, mean ± SD (range). n = 44 | 1.5 ± 1.8 (0-7) n = 24 | 7.1 ± 3.6 (0-15) n = 20 | < 0.012 |
| BMI (kg/m²), mean ± SD (range), n = 45 | 25.2 ± 5.3 (16.5-40.7) (n = 25) | 25.6 ± 5.5 (18.2-38.4) (n = 20) | 0.852 |
| Presence of at least one extraintestinal manifestation n (%), n = 45 (%) | 1 (4.2) n = 24 | 6 (28.6) n = 21 | 0.021 |
| Ustekinumab dosing interval 8 wk, n = 46 (%) | 13 (52.0) | 11 (52.4) | 0.981 |
| Endoscopic, MRI and ultrasound findings at 24 ± 6 wk | |||
| Colonoscopy, n = 5 | 0 | 5 | |
| Mucosal healing, n (%) | 0 (0) | ||
| MRI, n = 7 | 1 | 6 | |
| No inflammation or improvement of inflammation, n (%) | 1 (100) | 3 (50) | 0.231 |
| Ultrasound, n = 13 | 8 | 5 | |
| Wall thickening > 3 mm, n (%) | 3 (37.5) | 3 (60.0) | 0.431 |
| Endoscopic, MRI and ultrasound findings at 24 to 48 ± 6 wk | |||
| Colonoscopy, n = 17 | 8 | 9 | |
| Mucosal healing, n (%) | 5 (62.5) | 2 (22.2) | 0.091 |
| MRI, n = 12 | 6 | 6 | |
| No inflammation or improvement of inflammation, n (%) | 4 (66.7) | 3 (50) | 0.561 |
| Ultrasound, n = 26 | 13 | 13 | |
| Wall thickening > 3 mm, n (%) | 6 (46.2) | 5 (38.5) | 0.691 |
| Biochemical parameters | |||
| Plasma CRP concentration (mg/L), median (range), n = 44 | 3.6 (0.6-35.3) n = 23 | 3.4 (1-58.9) n = 21 | 0.582 |
| WCC (/nL), median (range), n = 45 | 8.0 (3.7-13.5) n = 23 | 9.4 (5.4-14.6) n = 22 | 0.082 |
| Haemoglobin concentration (g/dL), mean ± SD (range), n = 45 | 13.9 ± 1.2 (11.0-16.2) n = 23 | 13.4 ± 1.8 (8.5-15.9) n = 22 | 0.362 |
| PLT count (/nL), mean ± SD (range), n = 45 | 314 ± 63.9 (215-442) n = 23 | 302 ± 111.7 (155-573) n = 22 | 0.312 |
| Plasma albumin concentration (g/L), mean ± SD (range), n = 39 | 44.5 ± 2.5 (39.4-50.0) n = 21 | 42.4 ± 5.7 (22.90-48.9) n = 18 | 0.242 |
| Plasma ferritin concentration (µg/L), median (range), n = 33 | 70.0 (9.0-296.0) n = 19 | 63.0 (6.0-884.0) n = 14 | 0.962 |
| Transferrin saturation (%), mean ± SD (range), n = 31 | 19.2 ± 6.8 (9.0-34.0) n = 19 | 16.8 ± 7.1 (4.0-25.0) n = 12 | 0.612 |
| FC concentration (µg/g), median (range), n = 27 | 104 (30-1254) n = 16 | 254 (45-1261) n = 11 | 0.432 |
Table 6 Adverse events and infections in the study cohort listed according to the time of their occurrence
| Therapy week | 6 | 12 | 24 | 36 | 48 |
| n | 55 | 51 | 48 | 38 | 28 |
| Adverse events and infections | |||||
| Adverse events, n (%) | 29 (52.7) | 18 (35.3) | 13 (27.1) | 20 (52.6) | 18 (64.3) |
| Sweat, n (%) | 2 (3.6) | 0 | 2 (4.2) | 1 (2.6) | 1 (3.6) |
| Dizziness, n (%) | 0 | 1 (2.0) | 0 | 1 (2.6) | 2 (7.1) |
| Arthralgia, n (%) | 6 (10.1) | 6 (11.8) | 4 (8.3) | 5 (13.2) | 2 (7.1) |
| Muscle cramps, n (%) | 0 | 0 | 1 (2.1) | 0 | 0 |
| Loss of hair, n (%) | 1 (1.8) | 1 (2.0) | 2 (4.2) | 1 (2.6) | 1 (3.6) |
| Skin itching, n (%) | 2 (3.6) | 3 (5.9) | 1 (2.1) | 1 (2.6) | 0 |
| Headaches, n (%) | 4 (7.3) | 2 (3.9) | 1 (2.1) | 2 (5.3) | 2 (7.1) |
| Restlessness, n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Fatigue, n (%) | 3 (5.4) | 2 (3.9) | 0 | 2 (5.3) | 1 (3.6) |
| Skin lesions, n (%) | 3 (5.4) | 1 (2.0) | 1 (2.1) | 4 (10.5) | 2 (7.1) |
| Arterial hypertension, n (%) | 1 (1.8) | 0 | 0 | 2 (5.3) | 1 (3.6) |
| Palpitations, n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Eye problems, n (%) | 1 (1.8) | 1 (2.0) | 1 (2.1) | 0 | 0 |
| Nausea, n (%) | 2 (3.6) | 1 | 0 | 1 (2.6) | 0 |
| Diarrhoea, n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Vomiting, n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Infections, n (%) | 5 (9.1) | 5 (9.8) | 8 (16.7) | 0 | 6 (21.4) |
| Tonsillitis, n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Upper respiratory infection, n (%) | 2 (3.6) | 3 (5.9) | 6 (12.5) | 0 | 6 (21.4) |
| Enteritis (salmonella), n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Vaginal infection, n (%) | 1 (1.8) | 0 | 0 | 0 | 0 |
| Cytomegalovirus infection, n (%) | 0 | 1 (2.0) | 0 | 0 | 0 |
| Otitis externa, n (%) | 0 | 1 (2.0) | 1 (2.1) | 0 | 0 |
| Fever of unknown origin, n (%) | 0 | 0 | 1 (2.1) | 0 | 0 |
- Citation: Hoffmann P, Krisam J, Wehling C, Kloeters-Plachky P, Leopold Y, Belling N, Gauss A. Ustekinumab: “Real-world” outcomes and potential predictors of nonresponse in treatment-refractory Crohn’s disease. World J Gastroenterol 2019; 25(31): 4481-4492
- URL: https://www.wjgnet.com/1007-9327/full/v25/i31/4481.htm
- DOI: https://dx.doi.org/10.3748/wjg.v25.i31.4481