Ustekinumab: “Real-world” outcomes and potential predictors of nonresponse in treatment-refractory Crohn’s disease

Table 1 Primers for polymerase chain reaction

Wild type gene	Primers, 5'-3'	Annealing temperature (°C)
NOD2 (2104C) R702W	CCAGACATCTGAGAAGGCCCTGCTC	65
rs2066844	GGCGCCAGGCCTGTGCCCGCTGGTG
NOD2 (2722G)	CTCTTTTGGCCTTTTCAGATTCTGG	52
rs2066845	GCAACAGAGTGGGTGACGAGGGGGC
NOD2 (3020T) 3020insC	GGGGCAGAAGCCCTCCTGCAGGCCC	54
rs2066847	TTGAAAGGAATGACACCATCCTGGA

NOD2: Nucleotide-binding oligomerisation domain 2.

Table 2 Baseline characteristics

Variable	n = 57
Male, n (%)	30 (52.6)
Age at start of treatment (yr), median (range)	43.0 (21-68)
Montreal classification of CD:
Age, n (A1:A2:A3)	4:40:13
Location, n (L1:L2:L3:L4)	18:9:30:4
Behaviour, n (B1:B2:B3), n = 56	17:16:23
Prior CD-related intestinal resection, n (%)	36 (63.2)
First degree relative(s) with IBD, n (%), n = 49	8 (14.0)
Disease duration at baseline (yr), median (range)	43 (21-68)
Presence of at least one extraintestinal manifestation, n (%)	30 (52.6)
Active cigarette smoking, n (%)	17 (29.8)
BMI (kg/m²), mean ± SD (range), n = 56	24.7 ± 5.1 (17.9-40.7)
History of anti-TNF-α treatment, n (%)	54 (94.7)
History of anti-integrin treatment, n (%)	16 (28.1)
History of immunomodulator treatment, n (%)	47 (82.5)
History of total hospitalisations within 12 months from baseline, n (%)	14 (24.6)
History of CD-related hospitalisations within 12 mo from baseline, n (%)	12 (21.1)
HBI, mean ± SD (range), n = 51	6.6 ± 5.1 (0-24)
Prior exposure to
0 biologics, n (%)	3 (5.3)
1 biologic, n (%)	14 (24.6)
2 biologics, n (%)	27 (47.4)
3 biologics, n (%)	13 (22.8)
Endoscopic, MRI and ultrasound findings at 0-12 weeks to baseline
Ulcers in colonoscopy, n (%), n = 25	21 (84.0)
Inflammation in MRI, n (%), n = 21	20 (95.2)
Ultrasound wall thickening > 3 mm, n (%), n = 22	19 (79.2)
Reason for starting ustekinumab therapy
Clinical disease activity, n (%)	34 (59.6)
Imaging (MRI, ultrasound, endoscopy results), n (%)	17 (29.8)
High FC concentration, n (%)	2 (3.5)
Loss of effect of prior therapy, n (%)	2 (3.5)
Intolerance of prior therapy, n (%)	2 (3.5)
Concomitant medications at baseline
Steroids (including budesonide), n (%)	20 (35.1)
Immunomodulators, n (%)	3 (5.3)
NOD2 genotyping
NOD2 rs2066844, n (CC:TT:CT), n = 42	34:0:8
NOD2 rs2066845, n (CC:GG:CG), n = 42	1:34:7
NOD2 rs2066847, n (--:CC:C-), n = 42	35:0:7
Biochemical parameters at baseline
Plasma CRP concentration (mg/L), median (range), n = 56	8.0 (1.0-82.4)
WCC, (/nL), median (range), n = 56	9.2 (4.0-19.1)
Haemoglobin concentration (g/dL), mean ± SD (range), n = 56	13.33 ± 1.6 (8.8-16.5)
PLT count (/nL), mean ± SD (range), n = 56	329.8 ± 132.3 (146-845)
Plasma albumin concentration (g/L), mean ± SD (range), n = 54	43.1 ± 3.5 (33.2-49.0)
Plasma ferritin concentration (µg/L), median (range), n = 40	83.0 (4-591)
Transferrin saturation (%), mean ± SD (range), n = 36	18.2 ± 13.2 (2-58)
FC concentration (µg/g), median (range), n = 24	351.2 (30-1800)

BMI: Body mass index; CD: Crohn’s disease; CRP: C-reactive protein; FC: Faecal calprotectin; HBI: Harvey-Bradshaw-Index; MRI: Magnetic resonance imaging; NOD2: Nucleotide oligodimerisation domain 2; PLT: Platelet; SD: Standard deviation; TNF-α: Tumour necrosis factor alpha; WCC: White blood cell count.

Table 3 Comparison of baseline characteristics between the subgroups of patients with steroid-free clinical response versus non-responders to ustekinumab therapy

Parameter	Steroid-free clinical remission/response	Nonresponse	P value
n = 57 (%)	26 (45.6)	31 (54.4)
Male, n (%)	10 (38.5)	20 (64.5)	0.051
Age at baseline (yr), median (range)	41.5 (22–68)	44 (21–68)	0.812
Montreal classification of CD
Age, n (A1:A2:A3)	2:17:7	2:23:6	0.761
Location, n (L1:L2:L3)	8:4:14	10:5:16	0.991
Location L4, n (%)	1 (3.8)	3 (9.7)	0.621
Behaviour, n (B1:B2:B3), n = 56	8:6:11	9:10:12	0.791
Prior CD-related intestinal resections, n (%)	17 (65.4)	19 (61.3)	0.751
First degree relative(s) with IBD, n (%), n = 49	4 (15.4)	4 (17.4)	1.001
Disease duration at baseline (yr), median (range)	10 (1-32)	14 (0-40)	0.432
Presence of at least one extraintestinal manifestation, n (%)	9 (34.6)	21 (67.7)	0.011
Active cigarette smoking, n (%)	8 (30.1)	9 (29.0)	0.891
BMI (kg/m²), mean ± SD (range), n = 56	25.1 ± 5.3 (18.0–40.7) (n = 26)	24.3 ± 5.0 (17.9–39.7) (n = 30)	0.442
History of anti-TNF-α treatment, n (%)	25 (94.7)	29 (93.5)	0.661
History of anti-integrin treatment, n (%)	7 (26.9)	9 (29.0)	0.861
History of immunomodulator treatment, n (%)	22 (84.6)	25 (80.6)	0.691
History of total hospitalisations within 12 months from baseline, n (%)	4 (15.4)	10 (32.3)	0.221
History of CD-related hospitalisations within 12 mo from baseline, n (%)	3 (11.5)	9 (29.0)	0.191
HBI at baseline, mean ± SD (range), n = 51	4.7 ± 4.3 (0-14) (n = 23)	8.1 ± 5.3 (1-24) (n = 28)	0.012
Prior exposure to			0.961
0 biologics, n (%)	1 (3.8)	2 (6.5)
1 biologic, n (%)	6 (23.1)	8 (25.8)
2 biologics, n (%)	13 (50.0)	14 (45.2)
3 biologics, n (%)	6 (23.1)	7 (22.6)
Concomitant medication at baseline
Steroids (including budesonide), n (%)	4 (15.4)	16 (51.6)	0.0041
Immunomodulators, n (%)	2 (7.7)	1 (3.2)	0.451
NOD2 genotyping
NOD2 rs2066844; n = 42 (CC:TT:CT)	15:0:4	19:0:4	0.761
NOD2 rs2066845, n = 42 (CC:GG:CG)	1:16:2	0:18:5	0.361
NOD2 rs2066847, n = 42 (--:CC:C-)	17:0:2	18:0:5	0.331
Biochemical parameters at baseline
Plasma CRP concentration (mg/L), median (range), n=56	7.8 (1.0-57.1) n = 26	8.9 (1.0-82.4) n = 30	0.642
WCC (/nL), median (range), n = 56	9.0 (4.0-15.8) n = 26	9.2 (4.9-19.1) n = 30	0.342
Haemoglobin concentration (g/dL), mean ± SD (range), n = 56	13.3 ± 1.8 (8.8-16.5) n = 26	13.4 ± 1.5 (10.5-16.1) n = 30	0.892
PLT count (/nL), mean ± SD (range), n = 56	322 ± 65.0 (208-431) n = 26	337 ± 171.6 (146-845) n = 30	0.262
Plasma albumin concentration (g/L), mean ± SD (range), n = 54	42.8 ± 3.7 (33.2-49.0) n = 25	43.3 ± 3.4 (36.2-49.0) n = 29	0.522
Plasma ferritin concentration (µg/L), median (range), n = 40	69.5 (4.0-428.0) n = 18	134.5 (9.0-591.0) n = 22	0.142
Transferrin saturation (%), mean ± SD (range), n = 36	15.4 ± 12.4 (2.0-45.0) n = 16	20.4 ± 13.7 (6.0-58.0) n = 20	0.192
FC concentration (µg/g), median (range), n = 24	451 (30-1800) n = 8	302 (74-1800) n = 16	0.882

¹Chi-squared test;

²Mann-Whitney-test. BMI: Body mass index; CRP: C-reactive protein; FC: Faecal calprotectin; HBI: Harvey-Bradshaw-Index; NOD2: Nucleotide oligodimerisation domain 2; PLT: Platelet; SD: Standard deviation; TNF-α: Tumour necrosis factor alpha; WCC: White blood cell count.

Table 4 Characteristics entering the multivariable logistic regression model

Parameter	OR	95%CI	P value
Male sex	0.112	(0.021; 0.605)	0.011
Extraintestinal manifestations	0.119	(0.022; 0.636)	0.013
HBI at baseline	0.853	(0.718; 1.014)	0.071
Use of steroids (including budesonide) at baseline	0.071	(0.011; 0.464)	0.006

Only variables listed in Table 3 with a univariable P value below 0.1 were considered for logistic regression model. Area under the curve: 91.07% (95%CI = 81.64%-100%).

Table 5 Comparison between parameters determined at 24 ± 6 wk from start of ustekinumab therapy between steroid-free clinical responders and non-responders

	Steroid-free clinical remission or response	Nonresponse	P value
n = 48 (%)	26 (45.6)	22 (38.6)
HBI, mean ± SD (range). n = 44	1.5 ± 1.8 (0-7) n = 24	7.1 ± 3.6 (0-15) n = 20	< 0.012
BMI (kg/m²), mean ± SD (range), n = 45	25.2 ± 5.3 (16.5-40.7) (n = 25)	25.6 ± 5.5 (18.2-38.4) (n = 20)	0.852
Presence of at least one extraintestinal manifestation n (%), n = 45 (%)	1 (4.2) n = 24	6 (28.6) n = 21	0.021
Ustekinumab dosing interval 8 wk, n = 46 (%)	13 (52.0)	11 (52.4)	0.981
Endoscopic, MRI and ultrasound findings at 24 ± 6 wk
Colonoscopy, n = 5	0	5
Mucosal healing, n (%)		0 (0)
MRI, n = 7	1	6
No inflammation or improvement of inflammation, n (%)	1 (100)	3 (50)	0.231
Ultrasound, n = 13	8	5
Wall thickening > 3 mm, n (%)	3 (37.5)	3 (60.0)	0.431
Endoscopic, MRI and ultrasound findings at 24 to 48 ± 6 wk
Colonoscopy, n = 17	8	9
Mucosal healing, n (%)	5 (62.5)	2 (22.2)	0.091
MRI, n = 12	6	6
No inflammation or improvement of inflammation, n (%)	4 (66.7)	3 (50)	0.561
Ultrasound, n = 26	13	13
Wall thickening > 3 mm, n (%)	6 (46.2)	5 (38.5)	0.691
Biochemical parameters
Plasma CRP concentration (mg/L), median (range), n = 44	3.6 (0.6-35.3) n = 23	3.4 (1-58.9) n = 21	0.582
WCC (/nL), median (range), n = 45	8.0 (3.7-13.5) n = 23	9.4 (5.4-14.6) n = 22	0.082
Haemoglobin concentration (g/dL), mean ± SD (range), n = 45	13.9 ± 1.2 (11.0-16.2) n = 23	13.4 ± 1.8 (8.5-15.9) n = 22	0.362
PLT count (/nL), mean ± SD (range), n = 45	314 ± 63.9 (215-442) n = 23	302 ± 111.7 (155-573) n = 22	0.312
Plasma albumin concentration (g/L), mean ± SD (range), n = 39	44.5 ± 2.5 (39.4-50.0) n = 21	42.4 ± 5.7 (22.90-48.9) n = 18	0.242
Plasma ferritin concentration (µg/L), median (range), n = 33	70.0 (9.0-296.0) n = 19	63.0 (6.0-884.0) n = 14	0.962
Transferrin saturation (%), mean ± SD (range), n = 31	19.2 ± 6.8 (9.0-34.0) n = 19	16.8 ± 7.1 (4.0-25.0) n = 12	0.612
FC concentration (µg/g), median (range), n = 27	104 (30-1254) n = 16	254 (45-1261) n = 11	0.432

¹Chi-squared test;

²Mann-Whitney-test. BMI: Body mass index; CRP: C-reactive protein; FC: Faecal calprotectin; HBI: Harvey-Bradshaw-Index; MRI: Magnetic resonance imaging; PLT: Platelet; WCC: White blood cell.

Table 6 Adverse events and infections in the study cohort listed according to the time of their occurrence

Therapy week	6	12	24	36	48
n	55	51	48	38	28
Adverse events and infections
Adverse events, n (%)	29 (52.7)	18 (35.3)	13 (27.1)	20 (52.6)	18 (64.3)
Sweat, n (%)	2 (3.6)	0	2 (4.2)	1 (2.6)	1 (3.6)
Dizziness, n (%)	0	1 (2.0)	0	1 (2.6)	2 (7.1)
Arthralgia, n (%)	6 (10.1)	6 (11.8)	4 (8.3)	5 (13.2)	2 (7.1)
Muscle cramps, n (%)	0	0	1 (2.1)	0	0
Loss of hair, n (%)	1 (1.8)	1 (2.0)	2 (4.2)	1 (2.6)	1 (3.6)
Skin itching, n (%)	2 (3.6)	3 (5.9)	1 (2.1)	1 (2.6)	0
Headaches, n (%)	4 (7.3)	2 (3.9)	1 (2.1)	2 (5.3)	2 (7.1)
Restlessness, n (%)	1 (1.8)	0	0	0	0
Fatigue, n (%)	3 (5.4)	2 (3.9)	0	2 (5.3)	1 (3.6)
Skin lesions, n (%)	3 (5.4)	1 (2.0)	1 (2.1)	4 (10.5)	2 (7.1)
Arterial hypertension, n (%)	1 (1.8)	0	0	2 (5.3)	1 (3.6)
Palpitations, n (%)	1 (1.8)	0	0	0	0
Eye problems, n (%)	1 (1.8)	1 (2.0)	1 (2.1)	0	0
Nausea, n (%)	2 (3.6)	1	0	1 (2.6)	0
Diarrhoea, n (%)	1 (1.8)	0	0	0	0
Vomiting, n (%)	1 (1.8)	0	0	0	0
Infections, n (%)	5 (9.1)	5 (9.8)	8 (16.7)	0	6 (21.4)
Tonsillitis, n (%)	1 (1.8)	0	0	0	0
Upper respiratory infection, n (%)	2 (3.6)	3 (5.9)	6 (12.5)	0	6 (21.4)
Enteritis (salmonella), n (%)	1 (1.8)	0	0	0	0
Vaginal infection, n (%)	1 (1.8)	0	0	0	0
Cytomegalovirus infection, n (%)	0	1 (2.0)	0	0	0
Otitis externa, n (%)	0	1 (2.0)	1 (2.1)	0	0
Fever of unknown origin, n (%)	0	0	1 (2.1)	0	0