©The Author(s) 2016.
World J Gastroenterol. Nov 14, 2016; 22(42): 9346-9355
Published online Nov 14, 2016. doi: 10.3748/wjg.v22.i42.9346
Published online Nov 14, 2016. doi: 10.3748/wjg.v22.i42.9346
Table 1 Primer sequences, polymerase chain reaction conditions, and product sizes of different genes
| Polymorphism site | Primer sequence (5'-3') | PCR conditions | Product size (bp) |
| TLR4 (Asp299gly) | (1) 95 °C for 10 min | 249 | |
| (2) 35 cycles of : | |||
| F: GATTAGCATACTTAGACTACTACCTCCATG | 94 °C for 1 min | ||
| R: GATCAACTTCTGAAAAAGCATTCCCAC | 61.5 °C for 1 min | ||
| 72 °C for 1 min | |||
| (3) 72 °C for 7 min | |||
| TLR4 (Thr399Ile) | (1) 95 °C for 10 min | 406 | |
| (2) 35 cycles of : | |||
| F: GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA | 94 °C for 1 min | ||
| R: CCTGAAGACTGGAGAGTGAGTTAAATGCT | 64.8 °C for 1 min | ||
| 72 °C for 1 min | |||
| (3) 72 °C for 10 min | |||
| TLR2 (Arg753Gln) | (1) 95 °C for 10 min | 289 | |
| (2) 35 cycles of : | |||
| F: 5’-CCTTCAAGTTGTGTCTTCATAAG-3’ | 94 °C for 1 min | ||
| R: 5’-GGCCACTCCAGGTAGGTCTT-3’ | 58.6 °C for 1 min | ||
| 72 °C for 1 min | |||
| (3) 72 °C for 10 min | |||
| CD14 (-550C/T) | (1) 95 °C for 10 min | 368 | |
| (2) 32 cycles of : | |||
| F: GGAAGGGGGAATTTTTCTTTAGGC | 94 °C for 1 min | ||
| R: -GGCAGTGTCCTGATGACTCA | 59.8 °C for 1 min | ||
| 72 °C for 1 min | |||
| (3) 72 °C for 7 min | |||
| CD14 (-159C/T) | (1) 95 °C for 10 min | 296 | |
| (2) 35 cycles of : | |||
| F: ATCATCCTTTTCCCACACC | 94 °C for 40 s | ||
| R: AACTCTTCGGCTGCCTCT | 61 °C for 40 s | ||
| 72 °C for 40 s | |||
| (3) 72 °C for 10 min |
Table 2 Restriction fragment length polymorphism conditions
| Polymorphic site | Restriction enzyme | Incubation temperature and duration | Genotype and restriction fragment pattern (bp) |
| (units used) | |||
| TLR4 (Asp299gly) | NcoI | 37 °C for 16 h | AA: 249 |
| AG: 249, 223, 26 | |||
| GG: 223, 26 | |||
| TLR4 (Thr399Ile) | HinfI | 37 °C for 8 h | CC: 406 |
| CT: 406, 377, 29 | |||
| TT: 377, 29 | |||
| TLR2 (Arg753Gln) | AciI | 37 °C for 16 h | GG: 252 and 37 |
| GA: 252, 37, 289 | |||
| AA:289 | |||
| CD14 (-550C/T) | HaeIII | 37 °C for 12 h | CC: 23, 236, 109 |
| CT: 23, 236, 109, 259 | |||
| TT: 109, 259 | |||
| CD14 (-159C/T) | HaeIII | 37 °C for 16 h | CC: 141, 154 |
| CT: 141, 154, 296 | |||
| TT: 296 |
Table 3 Anthropometric and biochemical characteristics of patients with non-alcoholic fatty liver disease and healthy volunteers n (%)
| Parameters | NAFLD (n = 200) | HVs (n = 50) | P value |
| Mean age (yr) | 38.27 ± 10.3 | 36.56 ± 4.2 | 0.218 |
| Gender | 122 M/78 F | 38 M/12 F | |
| Mean BMI (kg/m2) | 27.16 ± 4.7 | 22.1 ± 1.2 | 0.0002 |
| Lean | 35 (17.5) | 46 (92) | 0.0001 |
| Overweight | 39 (19.5) | 3 (6) | 0.02 |
| Class I obesity | 87 (43.5) | 1 (2) | 0.0001 |
| Class II obesity | 39 (19.5) | 0 (0) | 0.003 |
| Waist (cm) | 91.20 ± 9.5 | 78.12 ± 4.6 | 0.0001 |
| Hip (cm) | 91.32 (89.90-93.94) | 89.18 (86.18-93.98) | 0.3 |
| Waist/hip ratio | 0.99 (0.98-1.01) | 0.93 (0.89-0.97) | 0.016 |
| Central obesity | 135 (67.5) | 0 (0) | 0.0001 |
| Mean AST (IU/L) | 60.27 (46.0-78.7) | 22.9 (18.75-29.50) | 0.0001 |
| Mean ALT (IU/L) | 88.04 (68.9-118.9) | 24 (17-29.5) | 0.0001 |
| Mean fasting sugar (mg/dL) | 94.95 (87-105.8) | 83.50 (75-89.25) | 0.0001 |
| Diabetes mellitus | 29 (14.5) | 0 (0) | 0.005 |
| Mean HDL (mg/dL) | 43 (38-48.9) | 52 (47.5-56) | 0.0001 |
| Mean Triglyceride (mg/dL) | 156 (126-200.2) | 102 (93-127.5) | 0.0001 |
| Hypertension | 48 (24) | 0 (0) | 0.0001 |
Table 4 Distribution of CD14 -550C/T genotype, allele frequency and genetic models for CD14-550C/T n (%)
| CD14 C (-550) T | CC | CT | TT |
| genotypes | |||
| Cases (n = 200) | 120 (60) | 65 (32.5) | 15 (7.5) |
| Control (n = 50) | 34 (68) | 14 (28) | 2 (4) |
| OR | 1 | 1.3 (0.6-2.6) | 2.1 (0.4-9.7) |
| P = 0.43 | P = 0.322 | ||
| Genetic models | |||
| Multiplicative model | Allele C | Allele T | |
| Cases | 305 (76.25) | 95 (23.75) | P = 0.21 |
| Control | 82 (82) | 18 (18) | OR = 1.41 |
| CI: 0.81-2.48 | |||
| Dominant model | CC | CT + TT | |
| Cases | 120 (60) | 80 (40) | P = 0.29 |
| Control | 34 (68) | 16 (32) | OR = 0.7 |
| CI: 0.3-1.3 | |||
| Recessive model | TT | CC + CT | |
| P = 0.37 | |||
| OR = 1.9 | |||
| CI: 0.4-8.8 | |||
Table 5 Distribution of CD14 -159C/T genotype, allele frequency and genetic models for CD14-159C/T n (%)
| CD14 C (-159) T | CC | CT | TT |
| Genotypes | |||
| Cases (n = 200) | 36 (18) | 70 (35) | 94 (47) |
| Control (n = 50) | 10 (20) | 30 (60) | 10 (20) |
| OR | 1 | 0.6 (0.2-1.4) | 2.6 (1-6.7) |
| P = 0.29 | P = 0.043 | ||
| Genetic models | |||
| Multiplicative model | Allele C | Allele T | |
| Cases | 142 (35.50) | 258 (64.50) | P = 0.007 |
| Control | 50 (50) | 50 (50) | OR = 0.8 |
| CI: 1.1-2.8 | |||
| Dominant model | CC | CT + TT | |
| Cases | 36 (18) | 164 (82) | P = 0.74 |
| Control | 10 (20) | 16 (32) | OR = 0.7 |
| CI: 0.4-1.9 | |||
| Recessive model | TT | CC + CT | |
| Cases | 94 (47) | 106 (53) | P = 0.0005 |
| Control | 10 (20) | 40 (80) | OR = 3.5 |
| CI: 1.6-7.4 -8.8 | |||
Table 6 Haplotypes for CD14 C (-159) T and C (-550) T polymorphism
| Haplotypes | NAFLD (frequency) | HVs (frequency) | P value | OR (95%CI) |
| (Fisher’s exact test) | ||||
| CC | 23.4% | 50% | 1.58E-007 | 0.3 (0.19-0.48) |
| TC | 52.3% | 32% | 0.0002 | 2.3 (1.4-3.7) |
| TT | 12.2% | 18% | 0.12 | 0.6 (0.3-1.1) |
| CT | 12.1% | 0% | 0.0002 | Undefined |
Table 7 Comparison of non-alcoholic fatty liver disease patients with and without CD14 C (-159) T polymorphism
| CD14 C (-159) T polymorphism (NAFLD = 200) | |||
| Parameters | Without polymorphism (n = 106) | With polymorphism (n = 94) | P value |
| TNF-α (pg/mL) (n = 200) | 56 (34-80) | 62 (40-112) | 0.04 |
| Adiponectin (pg/mL) | 745 (649-893) | 745 (634-928) | 0.93 |
| (n = 200) | |||
| IL-1β (pg/mL) | 43 (32-47) | 43 (25-47) | 0.53 |
| (n = 200) | |||
| HOMA-IR (n = 200) | 1.9 (1.3-2.7) | 1.8 (1.4-3.8) | 0.34 |
| MS (n = 200) | |||
| ≥ 3 components | 43 (40.5%) | 35 (37.2%) | 0.63 |
| ALT (IU/L) | 83 (68-108) | 95 (-130) | 0.016 |
| NAS score (n = 60) | 8 | 6 | 0.94 |
| No NASH | 11 | 10 | |
| Borderline NASH | 13 | 12 | |
| NASH | |||
| Severity of steatosis (n = 60) | |||
| 1 | 9 | 6 | |
| 2 | 14 | 15 | 0.733 |
| 3 | 9 | 7 | |
| Severity of fibrosis (n = 60) | |||
| 0 | 13 | 11 | 0.90 |
| 1 | 16 | 13 | |
| 2 | 1 | 2 | |
| 3 | 2 | 2 | |
- Citation: Kapil S, Duseja A, Sharma BK, Singla B, Chakraborti A, Das A, Ray P, Dhiman RK, Chawla Y. Genetic polymorphism in CD14 gene, a co-receptor of TLR4 associated with non-alcoholic fatty liver disease. World J Gastroenterol 2016; 22(42): 9346-9355
- URL: https://www.wjgnet.com/1007-9327/full/v22/i42/9346.htm
- DOI: https://dx.doi.org/10.3748/wjg.v22.i42.9346
