Coexpression of MYC and BCL-2 predicts prognosis in primary gastrointestinal diffuse large B-cell lymphoma

Table 1 Primer sequences

Genes	Forward sequence (5’→3’)	Reverse sequence (5’→3’)
MYC	CCTCCACTCGGAAGGACTATC	TGTTCGCCTCTTGACATTCTC
BCL-2	GTGGATGACTGAGTACCTGAACC	AGACAGCCAGGAGAAATCAAAC
β-actin	CCTGGCACCCAGCACAAT	GGGCCGGACTCGTCATAC

Table 2 Clinical characteristics of primary gastrointestinal diffuse large B-cell lymphoma patients

Clinical characteristics	n	DP	Non-DP	χ2	P
Patients	60	18	42
Age (yr)				2.534	0.111
≤ 60	34	13	21
> 60	26	5	21
Gender				0.051	0.821
Male	32	10	22
Female	28	8	20
Primary site				0.013	0.908
Stomach	36	11	25
Intestinal	24	7	17
Lugano staging system				22.781	< 0.0001
I-II2	36	2	34
IIE-IV	24	16	8
LDH				0.207	0.649
Normal	34	11	23
Elevated	26	7	19
B symptoms				0.277	0.599
Positive	7	1	6
Negative	53	17	36
IPI				2.286	0.131
0-2	50	13	37
3-5	10	5	5
Pathological type				2.188	0.139
Non-GCB	48	17	31
GCB	12	1	11
CD10 status				0.013	0.908
Positive	36	117	25
Negative/NA	24		17
CD5 status				2.265	0.127
Positive	49	13	36
Negative/NA	11	5	6
CD20 status				0.207	0.649
Positive	34	11	23
Negative/NA	26	7	19
Anemia				0.003	0.955
Present	33	10	23
Absent	27	8	19
Treatment				2.017	0.156
ST + CT	51	13	38
ST + CT + RT	9	5	4
Therapeutic evaluation
CR	48	9	39	11.910	0.001
PR/SD/PD	12	9	3

DP: MYC/BCL-2 protein double positive; Non-DP: Non-MYC/BCL-2 protein double positive; NA: Not available; ST: Surgery; CT: Chemotherapy; RT: Radiotherapy; CR: Complete remission; PR: Partial remission; SD: Stable disease; PD: Progressive disease.

Table 3 Associations between BCL-2 mRNA and BCL-2 protein expression

BCL-2	BCL-2 mRNA		r	P
	High	Low
Positive	18	9	0.640	< 0.0001
Negative	2	31

Table 4 Associations between MYC mRNA and MYC protein expression

MYC	MYC mRNA		r	P
	High	Low
Positive	17	4	0.430	0.0001
Negative	14	25

Table 5 Univariate analysis of prognostic factors for progression-free survival and overall survival in patients with primary gastrointestinal diffuse large B-cell lymphoma

Prognostic factors	n	OS		PFS
		χ2	P	χ2	P
Age (yr)		0.376	0.540	7.377	0.007
≤ 60	34
> 60	26
Gender		0.059	0.808	0.189	0.664
Male	32
Female	28
Primary site		0.132	0.717	1.211	0.271
Stomach	36
Intestinal	24
Lugano staging system		13.355	< 0.0001	17.581	< 0.0001
I-II2	36
IIE-IV	24
LDH		0.029	0.864	0.118	0.731
Normal	34
Elevated	26
B symptoms		1.667	0.197	0.787	0.375
Positive	7
Negative	53
IPI		27.098	< 0.0001	39.737	< 0.0001
0-2	50
3-5	10
Pathological type		0.033	0.856	0.020	0.888
Non-GCB	48
GCB	12
Anemia		0.526	0.468	0.101	0.751
Present	33
Absent	27
Treatment		0.249	0.618	6.758	0.0093
ST + CT	51
ST + CT + RT	9
MYC protein expression		0.347	0.556	0.078	0.780
MYC+	21
MYC-	39
BCL-2 protein expression		10.701	0.001	19.463	< 0.0001
BCL-2+	27
BCL-2-	33
MYC/BCL-2 coexpression		10.956	0.001	15.198	< 0.0001
MYC+/BCL-2+	18
All others	42

OS: Overall survival; PFS: Progression-free survival; ST: Surgery; CT: Chemotherapy; RT: Radiotherapy; CR: Complete remission; IPI: International prognostic index; PR: Partial remission; SD: Stable disease; PD: Progressive disease.

Table 6 Factors retaining prognostic significance for progression-free survival and overall survival with multivariate and Cox proportional hazards analysis

Prognostic factors	OS			PFS
	HR	95%CI	P	HR	95%CI	P
Age	1.570	0.384-6.430	0.530	0.403	0.132-1.224	0.109
Lugano staging system	0.253	0.009-6.990	0.417	1.091	0.243-4.893	0.910
IPI	13.246	2.929-59.903	0.001	15.302	4.119-56.845	< 0.0001
Treatment	1.374	0.247-7.625	0.717	1.542	0.522-4.555	0.434
BCL-2 protein expression	1.056	0.029-37.972	0.976	1.773	0.154-20.434	0.646
MYC/BCL-2 coexpression	4.435	0.728-26.994	0.106	11.371	1.264-102.295	0.030

OS: Overall survival; PFS: Progression-free survival; IPI: International prognostic index.