BPG is committed to discovery and dissemination of knowledge
Retrospective Study
©The Author(s) 2015.
World J Gastroenterol. Feb 7, 2015; 21(5): 1595-1605
Published online Feb 7, 2015. doi: 10.3748/wjg.v21.i5.1595
Table 1 Primary antibodies for immunohistochemical staining for mismatch repair proteins
AntibodySupplied byClone No.Positive signal localizationDilutionIncubation temperature (°C)Incubationperiod (h)
MLH1Novocastra, UK14Nuclear1:50372
MSH2Novocastra, UKFE11Nuclear1:20372
MSH6Novocastra, UKBC/44Nuclear1:80372
PSM2Novocastra, UKEP51Nuclear1:30372
Table 2 Primer sequences for KRAS exon 2 and BRAF exons 15, annealing temperature and size of expected PCR products
ExonPrimer No.Primer sequence 5’-3’AT (°C)Product size (bp)
KRAS 22-FTAGTCACATTTTCATTATTTTTAT55160
2-RAGATTTACCTCTATTGTTGGAT
BRAF 1515-FATCTACTGTTTTCCTTTACTTACT55160
15-RATTCTTACCATCCACAAAATG
Table 3 Clinicopathological information of the studied patients n (%)
Clinical featureTotal cases
GenderMale306 (57.2)
Female229 (42.8)
Age (yr)< 5057 (10.7)
≥ 50478 (89.3)
LocationRight colon177 (32.9)
Left colon165 (30.7)
Rectum196 (36.4)
Tumor differentiationPoor94 (17.5)
Well-moderate444 (82.5)
Tumor stageI95 (17.7)
II168 (31.2)
III215 (40.0)
IV50 (9.3)
Not available10 (1.9)
Table 4 Correlations between KRAS and BRAF status and clinicopathological features n (%)
Clinicopathological featureKRAS
BRAF
Mutant/tested casesP valueMutant/tested casesP value
Gender
Male100/277 (36.1)0.3367/254 (2.8)0.048
Female84/208 (40.4)13/196 (6.6)
Age (yr)
< 5011/50 (22)0.0143/47 (6.4)0.758
≥ 50173/435 (39.8)17/403 (4.2)
Location
Right colon67/161 (41.6)0.31814/146 (9.6)0.001
Left colon50/150 (33.3)3/167 (2.1)
Rectum68/177 (38.4)3/140 (1.8)
Mucin production
With41/108 (38)0.99010/102 (9.8)0.006
Without144/380 (37.9)10/351 (2.8)
Tumor differentiation
Poor25/84 (29.8)0.0917/74 (9.5)0.045
Well-moderate160/404 (39.6)13/379 (3.4)
Tumor stage
I-II85/232 (36.6)0.55310/218 (4.6)0.918
III-IV97/247 (39.3)10/228 (4.4)
Table 5 Correlations between DNA mismatch repair protein deficiency and clinicopathological features n (%)
Clinicopathological featuredMMR
MLH1/PMS2
MSH2/MSH6
Defective/testedP valueDefective/testedP valueDefective/testedP value
Total55/481 (11.4)31/481 (6.4)24/481 (5.0)
GenderMale25/272 (9.2)0.09512/272 (4.4)0.03413/272 (4.8)0.970
Female29/206 (14.1)19/206 (9.2)10/206 (4.9)
Age (yr)< 509/50 (18.0)0.1143/50 (6.0))1.0006/50 (12.0)0.031
≥ 5045/428 (10.5)28/428 (6.5)17/428 (4.0)
LocationRight colon33/161 (20.5)0.00023/161 (14.3)0.00010/161 (6.2)0.446
Left colon13/142 (9.2)5/142 (3.5)8/142 (5.6)
Rectum9/178 (5.1)3/178 (1.7)6/178 (3.4)
Mucin productionWith20/99 (20.2)0.00211/99 (11.1)0.0349/99 (9.1)0.065
Without35/382 (9.2)20/382 (5.2)15/382 (3.9)
Tumor differentiationPoor13/79 (16.5)0.1256/79 (7.6)0.6497/79 (8.9)0.148
Well-moderate42/402 (10.4)25/402 (6.2)17/402 (4.2)
Tumor stageI-II37/246 (15.0)0.01220/246 (8.1)0.12717/246 (6.9)0.049
III-IV18/234 (7.7)11/234 (4.7)7/234 (3.0)
Table 6 Correlations between DNA mismatch repair protein expression deficiency and KRAS or BRAF status n (%)
MMR statusKRAS (n = 432)
BRAF (n = 424)
Mutant/tested casesP valueMutant/tested casesP value
dMMR9/48 (18.8)0.00214/43 (9.3)0.264
MLH1/PMS2 deficiency3/29 (10.3)0.00124/26 (15.4)0.0373
MSH2/MSH6 deficiency6/19 (31.6)0.38330/17 (0)0.8173
pMMR160/384 (41.7)16/381 (4.2)


Write to the Help Desk