©The Author(s) 2015.
World J Gastroenterol. Feb 7, 2015; 21(5): 1595-1605
Published online Feb 7, 2015. doi: 10.3748/wjg.v21.i5.1595
Published online Feb 7, 2015. doi: 10.3748/wjg.v21.i5.1595
Table 1 Primary antibodies for immunohistochemical staining for mismatch repair proteins
| Antibody | Supplied by | Clone No. | Positive signal localization | Dilution | Incubation temperature (°C) | Incubationperiod (h) |
| MLH1 | Novocastra, UK | 14 | Nuclear | 1:50 | 37 | 2 |
| MSH2 | Novocastra, UK | FE11 | Nuclear | 1:20 | 37 | 2 |
| MSH6 | Novocastra, UK | BC/44 | Nuclear | 1:80 | 37 | 2 |
| PSM2 | Novocastra, UK | EP51 | Nuclear | 1:30 | 37 | 2 |
Table 2 Primer sequences for KRAS exon 2 and BRAF exons 15, annealing temperature and size of expected PCR products
| Exon | Primer No. | Primer sequence 5’-3’ | AT (°C) | Product size (bp) |
| KRAS 2 | 2-F | TAGTCACATTTTCATTATTTTTAT | 55 | 160 |
| 2-R | AGATTTACCTCTATTGTTGGAT | |||
| BRAF 15 | 15-F | ATCTACTGTTTTCCTTTACTTACT | 55 | 160 |
| 15-R | ATTCTTACCATCCACAAAATG |
Table 3 Clinicopathological information of the studied patients n (%)
| Clinical feature | Total cases | |
| Gender | Male | 306 (57.2) |
| Female | 229 (42.8) | |
| Age (yr) | < 50 | 57 (10.7) |
| ≥ 50 | 478 (89.3) | |
| Location | Right colon | 177 (32.9) |
| Left colon | 165 (30.7) | |
| Rectum | 196 (36.4) | |
| Tumor differentiation | Poor | 94 (17.5) |
| Well-moderate | 444 (82.5) | |
| Tumor stage | I | 95 (17.7) |
| II | 168 (31.2) | |
| III | 215 (40.0) | |
| IV | 50 (9.3) | |
| Not available | 10 (1.9) | |
Table 4 Correlations between KRAS and BRAF status and clinicopathological features n (%)
| Clinicopathological feature | KRAS | BRAF | ||
| Mutant/tested cases | P value | Mutant/tested cases | P value | |
| Gender | ||||
| Male | 100/277 (36.1) | 0.336 | 7/254 (2.8) | 0.048 |
| Female | 84/208 (40.4) | 13/196 (6.6) | ||
| Age (yr) | ||||
| < 50 | 11/50 (22) | 0.014 | 3/47 (6.4) | 0.758 |
| ≥ 50 | 173/435 (39.8) | 17/403 (4.2) | ||
| Location | ||||
| Right colon | 67/161 (41.6) | 0.318 | 14/146 (9.6) | 0.001 |
| Left colon | 50/150 (33.3) | 3/167 (2.1) | ||
| Rectum | 68/177 (38.4) | 3/140 (1.8) | ||
| Mucin production | ||||
| With | 41/108 (38) | 0.990 | 10/102 (9.8) | 0.006 |
| Without | 144/380 (37.9) | 10/351 (2.8) | ||
| Tumor differentiation | ||||
| Poor | 25/84 (29.8) | 0.091 | 7/74 (9.5) | 0.045 |
| Well-moderate | 160/404 (39.6) | 13/379 (3.4) | ||
| Tumor stage | ||||
| I-II | 85/232 (36.6) | 0.553 | 10/218 (4.6) | 0.918 |
| III-IV | 97/247 (39.3) | 10/228 (4.4) | ||
Table 5 Correlations between DNA mismatch repair protein deficiency and clinicopathological features n (%)
| Clinicopathological feature | dMMR | MLH1/PMS2 | MSH2/MSH6 | ||||
| Defective/tested | P value | Defective/tested | P value | Defective/tested | P value | ||
| Total | 55/481 (11.4) | 31/481 (6.4) | 24/481 (5.0) | ||||
| Gender | Male | 25/272 (9.2) | 0.095 | 12/272 (4.4) | 0.034 | 13/272 (4.8) | 0.970 |
| Female | 29/206 (14.1) | 19/206 (9.2) | 10/206 (4.9) | ||||
| Age (yr) | < 50 | 9/50 (18.0) | 0.114 | 3/50 (6.0)) | 1.000 | 6/50 (12.0) | 0.031 |
| ≥ 50 | 45/428 (10.5) | 28/428 (6.5) | 17/428 (4.0) | ||||
| Location | Right colon | 33/161 (20.5) | 0.000 | 23/161 (14.3) | 0.000 | 10/161 (6.2) | 0.446 |
| Left colon | 13/142 (9.2) | 5/142 (3.5) | 8/142 (5.6) | ||||
| Rectum | 9/178 (5.1) | 3/178 (1.7) | 6/178 (3.4) | ||||
| Mucin production | With | 20/99 (20.2) | 0.002 | 11/99 (11.1) | 0.034 | 9/99 (9.1) | 0.065 |
| Without | 35/382 (9.2) | 20/382 (5.2) | 15/382 (3.9) | ||||
| Tumor differentiation | Poor | 13/79 (16.5) | 0.125 | 6/79 (7.6) | 0.649 | 7/79 (8.9) | 0.148 |
| Well-moderate | 42/402 (10.4) | 25/402 (6.2) | 17/402 (4.2) | ||||
| Tumor stage | I-II | 37/246 (15.0) | 0.012 | 20/246 (8.1) | 0.127 | 17/246 (6.9) | 0.049 |
| III-IV | 18/234 (7.7) | 11/234 (4.7) | 7/234 (3.0) | ||||
Table 6 Correlations between DNA mismatch repair protein expression deficiency and KRAS or BRAF status n (%)
-
Citation: Ye JX, Liu Y, Qin Y, Zhong HH, Yi WN, Shi XY.
KRAS andBRAF gene mutations and DNA mismatch repair status in Chinese colorectal carcinoma patients. World J Gastroenterol 2015; 21(5): 1595-1605 - URL: https://www.wjgnet.com/1007-9327/full/v21/i5/1595.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i5.1595
