Copyright
©The Author(s) 2015.
World J Gastroenterol. Dec 14, 2015; 21(46): 13042-13054
Published online Dec 14, 2015. doi: 10.3748/wjg.v21.i46.13042
Published online Dec 14, 2015. doi: 10.3748/wjg.v21.i46.13042
Table 1 Culture media and incubation conditions
| Bacterial group | Bacteria preparation | MIC | ||
| Medium | Incubation conditions | Medium | Incubation conditions | |
| Bacteroides | GAM1 agar | 37 °C anaerobic, 48 h | BHI2 (10% HS4) | 37 °C Anaerobic, 48 h |
| Bifidobacteria | BBL2 agar | 37 °C anaerobic, 48 h | RC2 | 37 °C Anaerobic, 48 h |
| Lactobacilli | LBS2 agar | 37 °C aerobic with 5% CO2 48 h | RC2 | 37 °C Anaerobic, 48 h |
| C. perfringens | SPS2 agar | 37 °C anaerobic, 48 h | RC2 | 37 °C Anaerobic, 48 h |
| Aerobic E. coli | EMB2 agar | 37 °C aerobic, 18 h | MH2 | 37 °C Aerobic, 18 h |
| Enterococci | BEA2 agar | 37 °C aerobic, 18 h | MH2 | 37 °C Aerobic, 18 h |
| Candida albicans | Salouraud2 agar | 37 °C aerobic, 18 h | Salouraud2 | 37 °C Aerobic, 18 h |
| Staphylococcus aureus | blood plate3 | 37 °C aerobic, 18 h | MH2 | 37 °C Aerobic, 18 h |
| Other bacteria | LB1 agar | 37 °C aerobic, 18 h | MH2 | 37 °C Aerobic, 18 h |
Table 2 Primers for target gut bacteria
| Target bacteria (amplicon size, bp) | Sequence (5’ to 3’) |
| Bifidobacteria sp. (243) | F: TCGCGTC(C/T)GGTGTGAAAG |
| R: CCACATCCAGC(A/G)TCCAC | |
| Lactobacilli sp. (341) | F: AGCAGTAGGGAATCTTCCA |
| R: CACCGCTACACATGGAG | |
| Clostridium perfringens groups (120) | F: ATGCAAGTCGAGCGA(G/T)G |
| R: TATGCGGTATTAATCT(C/T)CCTTT | |
| Enterobacteriaceae (195) | F: CATTGACGTTACCCGCAGAAGAAGC |
| R: CTCTACGAGACTCAAGCTTGC | |
| Enterococci sp. (144) | F: CCCTTATTGTTAGTTGCCATCATT |
| R: ACTCGTTGTACTTCCCATTGT | |
| Bacteroidetes (126) | F: GGARCATGTGGTTTAATTCGATGAT |
| R: AGCTGACGACAACCATGCAG | |
| Firmicutes (126) | F: GGAGYATGTGGTTTAATTCGAAGCA |
| R: AGCTGACGACAACCATGCAC |
Table 3 Richness, Shannon-Weiner diversity indices, and evenness
| Group | n | Richness | Shannon-Weiner | Evenness | |||||||||
| Hae III-FAM | Hae III-HEX | Hha I-FAM | Hha I-HEX | Hae III-FAM | Hae III-HEX | Hha I-FAM | Hha I-HEX | Hae III-FAM | Hae III-HEX | Hha I-FAM | Hha I-HEX | ||
| LR-L | 10 | 44.80 ± 8.64ac | 32.50 ± 5.20ac | 44.90 ± 14.90 | 24.00 ± 7.77 | 3.16 ± 0.31ac | 2.76 ± 0.22ac | 3.23 ± 0.20a | 2.36 ± 0.16 | 0.84 ± 0.07 | 0.80 ± 0.05 | 0.86 ± 0.03a | 0.76 ± 0.05 |
| LR-M | 10 | 31.70 ± 8.08 | 26.00 ± 5.68 | 39.40 ± 5.32 | 25.00 ± 4.99 | 2.93 ± 0.25 | 2.54 ± 0.18c | 3.19 ± 0.11a | 2.34 ± 0.15 | 0.85 ± 0.04 | 0.79 ± 0.05 | 0.87 ± 0.03a | 0.73 ± 0.05 |
| LR-H | 10 | 31.80 ± 11.79 | 24.50 ± 4.58 | 37.00 ± 7.56 | 26.40 ± 6.11 | 2.88 ± 0.38 | 2.50 ± 0.25c | 3.04 ± 0.18 | 2.51 ± 0.22 | 0.85 ± 0.04 | 0.79 ± 0.06 | 0.85 ± 0.04 | 0.77 ± 0.07 |
| Normal | 9 | 29.11 ± 10.40 | 21.56 ± 8.17 | 35.89 ± 7.03 | 21.44 ± 4.50 | 2.66 ± 0.25 | 2.28 ± 0.23a | 3.09 ± 0.22 | 2.35 ± 0.16 | 0.81 ± 0.08 | 0.77 ± 0.09 | 0.87 ± 0.04a | 0.77 ± 0.06 |
| HFD | 9 | 33.56 ± 11.20 | 27.11 ± 5.80 | 38.67 ± 12.75 | 24.78 ± 6.36 | 2.80 ± 0.47 | 2.50 ± 0.20c | 2.95 ± 0.39 | 2.38 ± 0.23 | 0.81 ± 0.06 | 0.76 ± 0.06 | 0.82 ± 0.04c | 0.75 ± 0.08 |
-
Citation: Xie ZM, Zhou T, Liao HY, Ye Q, Liu S, Qi L, Huang J, Zuo HJ, Pei XF. Effects of
Ligustrum robustum on gut microbes and obesity in rats. World J Gastroenterol 2015; 21(46): 13042-13054 - URL: https://www.wjgnet.com/1007-9327/full/v21/i46/13042.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i46.13042
