©The Author(s) 2015.
World J Gastroenterol. Sep 21, 2015; 21(35): 10150-10158
Published online Sep 21, 2015. doi: 10.3748/wjg.v21.i35.10150
Published online Sep 21, 2015. doi: 10.3748/wjg.v21.i35.10150
Table 1 Sequences of primer and PCR conditions
| Polymorphisms | Primers | Temperature, time and cycles for PCR |
| CTLA-4(+49) A/G | Forward: | Initial denaturation for 4min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at 67 °C and 1 min at 72 °C and final elongation 5 min at 72 °C |
| 5’CAAGGCTCAGCTGAACCTGGGT3’ | ||
| Reverse: | ||
| 5’TACCTTTAACTTCTGGCTTTG3’ | ||
| CTLA-4(+6230) G/A | Forward | Initial denaturation for 5 min at 94 °C, 30 cycles of 40 s at 94 °C, 30 s at 61 °C and 50 s at 72 °C and final elongation 7 min at 72 °C |
| CT60 Sens: | ||
| 5’ CACCACTATTTGGGATATACC 3’ | ||
| Reverse | ||
| CT60 Antis: | ||
| 5’ AGCTCTATATTTCAGGAAGGC 3’ |
Table 2 Clinical and viral characteristics of total patients group n (%)
| Characteristics | Patients (n = 500) |
| Gender M/F (SR) | 248/252 (0.98) |
| Age (mean ± SD, yr) | 54.8 ± 14.17 |
| Regional distribution | |
| Tunis | 220 (44) |
| North west | 50 (10) |
| North | 33 (6.6) |
| North East | 20 (4) |
| Center | 46 (9.2) |
| South | 131 (26.2) |
| Risk factors | |
| Blood transfusions | 169 (71) |
| Invasive procedures | 128 (53.8) |
| Erythropoïetin | 103 (25) |
| Sector | |
| Private | 405 (80) |
| Public | 94 (20) |
| Hemodialysis average duration (mo) | 118.17 ± 71.74 |
Table 3 Number and sectorization of different hemodialysis groups n (%)
| Groups | n | Region | No. of centers | n (%) | |||||||
| T | NW | N | NE | C | S | Pv | Pq | Pv | Pq | ||
| G1 | 240 | 105 (43.7) | 25 (10.4) | 1 6 (6.7) | 10 (4.2) | 22 (9.2) | 62 (25.8) | 65 | 19 | 191 (79.6) | 49 (20.4) |
| G2 | 260 | 115 (44.3) | 25 (9.6) | 17 (6.5) | 10 (3.8) | 24 (9.2) | 69 (26.6) | 72 | 24 | 214 (82.3) | 46 (17.7) |
| Persistence | 159 | 65 (40.9) | 13 (8.2) | 11 (6.9) | 10 (6.3) | 19 (11.9) | 41 (25.9) | 58 | 12 | 133 (83.6) | 26 (16.4) |
| Clearance | 148 | 52 (35.2) | 16 (10.8) | 6 (4) | 6 (4) | 17 (11,5) | 51 (34.5) | 53 | 10 | 132 (89.2) | 16 (10.8) |
Table 4 Distribution of different genotypes according to the Persistence and Clearance groups n (%)
| Genotypes | Persistence (n = 142) | Clearance (n = 39) |
| 1b | 105 (73.9) | 30 (76.9) |
| 1a | 2 (1.4) | 0 |
| 1a/1b | - | 1 (2.6) |
| 2a/2c | 14 (9.9) | 1 (2.6) |
| 3 | 2 (1.4) | 1 (2.6) |
| 4 | 19 (13.4) | 5 (12.8) |
| 1b/4 | - | 1 (2.5) |
Table 5 Distribution of genotypes and allele frequencies of CTLA-4 polymorphisms in healthy controls, total hepatitis C virus infected hemodialysis patients and different infected groups
| Haplotypes | Controls | Patients | G1 | G2 | Persistence | Clearance |
| (n = 358) | (n = 500) | (n = 240) | (n = 260) | (n = 159) | (n = 148) | |
| GA | 39% | 29.5% | 36% | 34.5% | 35.2% | 36% |
| GG | 29.9% | 35.3%1 | 26.7% | 32.2% | 28.3% | 32.9% |
| AG | 26.8% | 25.2% | 25.7% | 24.9% | 26.5% | 22.8% |
| AA | 4.2% | 10% | 11.6% | 8.4% | 10% | 8.3% |
Table 6 Haplotypic distribution of the 2 SNPs of CTLA-4 gene in different studied groups n (%)
| SNPs | Controls | Patients | G1 | G2 | Persistence | Clearance |
| (n = 358) | (n = 500) | (n = 240) | (n = 260) | (n = 159) | (n = 148) | |
| (+49) A/G CTLA4 | ||||||
| Genotypes | ||||||
| AA | 40 (11.2) | 77 (15.4) | 43 (17.9) | 34 (13.1) | 25 (15.7) | 19 (12.84) |
| AG | 142 (39.7) | 198 (39.6) | 93 (38.8) | 105 (40.4) | 66 (41.5) | 54 (36.5) |
| GG | 176 (49.2) | 225 (45) | 104 (43.3) | 121 (46.5) | 68 (42.8) | 75 (50.7) |
| Alleles | ||||||
| A | 0.31 | 0.352 | 179 (37.3) | 173 (33.3) | 116 (36.5) | 92 (31.1) |
| G | 0.69 | 0.648 | 301 (62.7) | 347 (66.7) | 202 (63.5) | 204 (68.9) |
| (+6230) G/A CTLA4 | ||||||
| Genotypes | ||||||
| GG | 124 (34.6) | 194 (38.8) | 97 (40.4) | 97 (37.3) | 65 (40.9) | 55 (37.2) |
| GA | 158 (44.1) | 217 (43.4) | 102 (42.5) | 115 (44.2) | 66 (41.5) | 64 (43.2) |
| AA | 76 (21.3) | 89 (17.8) | 41 (17.1) | 48 (18.5) | 28 (17.6) | 29 (19.6) |
| Alleles | ||||||
| G | 0.567 | 0.605 | 296 (61.7) | 309 (59.4) | 196 (61.6) | 174 (58.8) |
| A | 0.433 | 0.395 | 184 (38.3) | 211 (40.6) | 122 (38.4) | 124 (41.2) |
- Citation: Ksiaa Cheikhrouhou L, Lakhoua-Gorgi Y, Sfar I, Jendoubi-Ayed S, Aouadi H, Makhlouf M, Ayed K, Ben Abdallah T. Natural evolution of hepatitis C virus infection in hemodialysis Tunisian patients and CTLA-4 SNP's. World J Gastroenterol 2015; 21(35): 10150-10158
- URL: https://www.wjgnet.com/1007-9327/full/v21/i35/10150.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i35.10150