Natural evolution of hepatitis C virus infection in hemodialysis Tunisian patients and CTLA-4 SNP's

Table 1 Sequences of primer and PCR conditions

Polymorphisms	Primers	Temperature, time and cycles for PCR
CTLA-4(+49) A/G	Forward:	Initial denaturation for 4min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at 67 °C and 1 min at 72 °C and final elongation 5 min at 72 °C
	5’CAAGGCTCAGCTGAACCTGGGT3’
	Reverse:
	5’TACCTTTAACTTCTGGCTTTG3’
CTLA-4(+6230) G/A	Forward	Initial denaturation for 5 min at 94 °C, 30 cycles of 40 s at 94 °C, 30 s at 61 °C and 50 s at 72 °C and final elongation 7 min at 72 °C
	CT60 Sens:
	5’ CACCACTATTTGGGATATACC 3’
	Reverse
	CT60 Antis:
	5’ AGCTCTATATTTCAGGAAGGC 3’

Table 2 Clinical and viral characteristics of total patients group n (%)

Characteristics	Patients (n = 500)
Gender M/F (SR)	248/252 (0.98)
Age (mean ± SD, yr)	54.8 ± 14.17
Regional distribution
Tunis	220 (44)
North west	50 (10)
North	33 (6.6)
North East	20 (4)
Center	46 (9.2)
South	131 (26.2)
Risk factors
Blood transfusions	169 (71)
Invasive procedures	128 (53.8)
Erythropoïetin	103 (25)
Sector
Private	405 (80)
Public	94 (20)
Hemodialysis average duration (mo)	118.17 ± 71.74

SR: Sex ratio.

Table 3 Number and sectorization of different hemodialysis groups n (%)

Groups	n	Region						No. of centers		n (%)
		T	NW	N	NE	C	S	Pv	Pq	Pv	Pq
G1	240	105 (43.7)	25 (10.4)	1 6 (6.7)	10 (4.2)	22 (9.2)	62 (25.8)	65	19	191 (79.6)	49 (20.4)
G2	260	115 (44.3)	25 (9.6)	17 (6.5)	10 (3.8)	24 (9.2)	69 (26.6)	72	24	214 (82.3)	46 (17.7)
Persistence	159	65 (40.9)	13 (8.2)	11 (6.9)	10 (6.3)	19 (11.9)	41 (25.9)	58	12	133 (83.6)	26 (16.4)
Clearance	148	52 (35.2)	16 (10.8)	6 (4)	6 (4)	17 (11,5)	51 (34.5)	53	10	132 (89.2)	16 (10.8)

T: Tunis; NW: North West; N: North; C: Center; NE: North East; S: South; Pv: Private; Pq: Public.

Table 4 Distribution of different genotypes according to the Persistence and Clearance groups n (%)

Genotypes	Persistence (n = 142)	Clearance (n = 39)
1b	105 (73.9)	30 (76.9)
1a	2 (1.4)	0
1a/1b	-	1 (2.6)
2a/2c	14 (9.9)	1 (2.6)
3	2 (1.4)	1 (2.6)
4	19 (13.4)	5 (12.8)
1b/4	-	1 (2.5)

Table 5 Distribution of genotypes and allele frequencies of CTLA-4 polymorphisms in healthy controls, total hepatitis C virus infected hemodialysis patients and different infected groups

Haplotypes	Controls	Patients	G1	G2	Persistence	Clearance
	(n = 358)	(n = 500)	(n = 240)	(n = 260)	(n = 159)	(n = 148)
GA	39%	29.5%	36%	34.5%	35.2%	36%
GG	29.9%	35.3%1	26.7%	32.2%	28.3%	32.9%
AG	26.8%	25.2%	25.7%	24.9%	26.5%	22.8%
AA	4.2%	10%	11.6%	8.4%	10%	8.3%

¹P = 0.0036, OR = 1.42; 95%CI: 1.12-1.79.

Table 6 Haplotypic distribution of the 2 SNPs of CTLA-4 gene in different studied groups n (%)

SNPs	Controls	Patients	G1	G2	Persistence	Clearance
	(n = 358)	(n = 500)	(n = 240)	(n = 260)	(n = 159)	(n = 148)
(+49) A/G CTLA4
Genotypes
AA	40 (11.2)	77 (15.4)	43 (17.9)	34 (13.1)	25 (15.7)	19 (12.84)
AG	142 (39.7)	198 (39.6)	93 (38.8)	105 (40.4)	66 (41.5)	54 (36.5)
GG	176 (49.2)	225 (45)	104 (43.3)	121 (46.5)	68 (42.8)	75 (50.7)
Alleles
A	0.31	0.352	179 (37.3)	173 (33.3)	116 (36.5)	92 (31.1)
G	0.69	0.648	301 (62.7)	347 (66.7)	202 (63.5)	204 (68.9)
(+6230) G/A CTLA4
Genotypes
GG	124 (34.6)	194 (38.8)	97 (40.4)	97 (37.3)	65 (40.9)	55 (37.2)
GA	158 (44.1)	217 (43.4)	102 (42.5)	115 (44.2)	66 (41.5)	64 (43.2)
AA	76 (21.3)	89 (17.8)	41 (17.1)	48 (18.5)	28 (17.6)	29 (19.6)
Alleles
G	0.567	0.605	296 (61.7)	309 (59.4)	196 (61.6)	174 (58.8)
A	0.433	0.395	184 (38.3)	211 (40.6)	122 (38.4)	124 (41.2)