Copyright
        ©The Author(s) 2015.
    
    
        World J Gastroenterol. Aug 21, 2015; 21(31): 9403-9412
Published online Aug 21, 2015. doi: 10.3748/wjg.v21.i31.9403
Published online Aug 21, 2015. doi: 10.3748/wjg.v21.i31.9403
            Table 1 Primer sequences used in this study
        
    | Gene | Forward primer sequence (5'→3') | Reverse primer sequence (5'→3') | 
| CD11c | GGGATGCCGCCAAAATTCTC | ATTGCATAGCGGATGATGCCT | 
| GAPDH | GGAAGGTGAAGGTCGGAGTC | CGTTCTCAGCCTTGACGGT | 
            Table 2 Baseline characteristics of the low and high CD11c expression groups (n = 140)
        
    | Clinicopathological characteristics | All | CD11c expression | P value | ||||
| Low | High | ||||||
| No. | % | No. | % | No. | % | ||
| Gender | 0.113 | ||||||
| Male | 107 | 76.43 | 80 | 73.39 | 27 | 87.10 | |
| Female | 33 | 23.57 | 29 | 26.61 | 4 | 12.90 | |
| Age (yr) | 0.162 | ||||||
| About 45 | 12 | 8.57 | 9 | 8.26 | 3 | 9.68 | |
| About 60 | 66 | 47.14 | 56 | 51.38 | 10 | 32.26 | |
| > 60 | 62 | 44.29 | 44 | 40.37 | 18 | 58.06 | |
| Tumor location | |||||||
| Gastric cardia | 0.342 | ||||||
| No | 87 | 62.14 | 70 | 64.22 | 17 | 54.84 | |
| Yes | 53 | 37.86 | 39 | 35.78 | 14 | 45.16 | |
| Tumor size (cm)1 | < 0.001 | ||||||
| < 5 | 56 | 47.46 | 36 | 38.71 | 20 | 80.00 | |
| ≥ 5 | 62 | 52.54 | 57 | 61.29 | 5 | 20.00 | |
| Histological type2 | 0.042 | ||||||
| Differentiated | 54 | 40.60 | 37 | 35.92 | 17 | 56.67 | |
| Poorly differentiated | 79 | 59.40 | 66 | 64.08 | 13 | 43.33 | |
| Invasion to muscular layer3 | 0.004 | ||||||
| No | 14 | 11.57 | 7 | 7.29 | 7 | 28.00 | |
| Yes | 107 | 88.43 | 89 | 92.71 | 18 | 72.00 | |
| Nodal metastasis4 | 0.001 | ||||||
| No | 33 | 27.27 | 19 | 20.00 | 14 | 53.85 | |
| Yes | 88 | 72.73 | 76 | 80.00 | 12 | 46.15 | |
| Pathological grade | 0.047 | ||||||
| 1-2 | 17 | 12.14 | 13 | 11.93 | 4 | 12.90 | |
| 3 | 70 | 50.00 | 49 | 44.95 | 21 | 67.74 | |
| 4 | 53 | 37.86 | 47 | 43.12 | 6 | 19.35 | |
| UICC stage | 0.002 | ||||||
| I | 11 | 7.86 | 4 | 3.67 | 7 | 22.58 | |
| II | 27 | 19.29 | 22 | 20.18 | 5 | 16.13 | |
| III | 88 | 62.86 | 69 | 63.30 | 19 | 61.29 | |
| IV | 14 | 10.00 | 14 | 12.84 | 0 | 0.00 | |
| Endpoint: DFS | 0.038 | ||||||
| No recurrence | 20 | 14.29 | 12 | 11.01 | 8 | 25.81 | |
| Recurrence | 120 | 85.71 | 97 | 88.99 | 23 | 74.19 | |
| Endpoint: OS | 0.404 | ||||||
| Survival | 37 | 26.43 | 27 | 24.77 | 10 | 32.26 | |
| Died | 103 | 73.57 | 82 | 75.23 | 21 | 67.74 | |
            Table 3 Three- and 5-year overall survival and disease-free survival probability and median survival time (mo) in the low and high CD11c expression groups
        
    | Expression level of CD11c | 3-yr OS (95%CI) | 5-yr OS (95%CI) | Median survival time (95%CI)1 | 3-yr DFS (95%CI) | 5-yr DFS (95%CI) | Median disease free time (95%CI)2 | 
| Low | 39.2 (30.0-48.4) | 29.0 (20.2-37.8) | 28.0 (15.1-40.9) | 24.0 (19.8-28.2) | 11.9 (8.7-15.1) | 18.0 (14.6-21.4) | 
| High | 67.7 (59.3-76.1) | 51.4 (42.4-60.4) | 67.0 (53.9-80.1) | 63.7 (54.9-72.5) | 49.1 (39.8-58.4) | 64.0 (42.0-86.0) | 
            Table 4 Multivariate Cox model analysis of the association between CD11c expression and the risk of death and relapse n (%)
        
    | Clinicopathological parameters | Number | OS | DFS | ||||
| HR | 95%CI | P value | HR | 95%CI | P value | ||
| CD11C expression | |||||||
| Low | 109 (77.86) | 1.00 (ref) | 1.00 (ref) | ||||
| High | 31 (22.14) | 0.56 | 0.33-0.98 | 0.041 | 0.39 | 0.23-0.67 | 0.001 | 
| Gender | |||||||
| Male | 107 (76.43) | 1.00 (ref) | 1.00 (ref) | ||||
| Female | 33 (23.57) | 1.08 | 0.64-1.83 | 0.769 | 0.77 | 0.46-1.27 | 0.306 | 
| Age groups | |||||||
| About 45 | 12 (8.57) | 1.00 (ref) | 1.00 (ref) | ||||
| About 60 | 66 (47.14) | 0.52 | 0.25-1.08 | 0.080 | 0.51 | 0.26-1.03 | 0.060 | 
| > 60 | 62 (44.29) | 0.82 | 0.39-1.73 | 0.608 | 0.70 | 0.35-1.41 | 0.316 | 
| Gastric cardia | |||||||
| No | 87 (62.14) | 1.00 (ref) | 1.00 (ref) | ||||
| Yes | 53 (37.86) | 1.58 | 1.02-2.43 | 0.039 | 1.42 | 0.95-2.11 | 0.085 | 
| Histological type% | |||||||
| Differentiated | 54 (40.60) | 1.00 (ref) | 1.00 (ref) | ||||
| Poorly differentiated | 79 (59.40) | 1.26 | 0.79-2.02 | 0.333 | 1.025 | 0.68-1.56 | 0.907 | 
| Pathological grade | |||||||
| 1-2 | 17 (12.14) | 1.00 (ref) | 1.00 (ref) | ||||
| 3 | 70 (50.00) | 0.79 | 0.35-1.76 | 0.564 | 0.85 | 0.41-1.75 | 0.659 | 
| 4 | 53 (37.86) | 1.08 | 0.47-2.48 | 0.849 | 1.32 | 0.63-2.79 | 0.466 | 
| UICC stage | |||||||
| I | 11 (7.86) | 1.00 (ref) | 1.00 (ref) | ||||
| II | 27 (19.20) | 2.90 | 0.74-11.32 | 0.126 | 1.99 | 0.65-6.10 | 0.230 | 
| III | 88 (62.86) | 3.36 | 0.91-12.39 | 0.069 | 2.12 | 0.74-6.10 | 0.162 | 
| IV | 14 (10.00) | 9.94 | 2.46-40.19 | 0.001 | 9.20 | 2.75-30.78 | < 0.001 | 
            Table 5 Comparison of HRs and association between CD11c expression and the risk of death and relapse in different Cox models
        
    - Citation: Wang Y, Xu B, Hu WW, Chen LJ, Wu CP, Lu BF, Shen YP, Jiang JT. High expression of CD11c indicates favorable prognosis in patients with gastric cancer. World J Gastroenterol 2015; 21(31): 9403-9412
 - URL: https://www.wjgnet.com/1007-9327/full/v21/i31/9403.htm
 - DOI: https://dx.doi.org/10.3748/wjg.v21.i31.9403
 
