Copyright
©The Author(s) 2015.
World J Gastroenterol. Jun 21, 2015; 21(23): 7172-7180
Published online Jun 21, 2015. doi: 10.3748/wjg.v21.i23.7172
Published online Jun 21, 2015. doi: 10.3748/wjg.v21.i23.7172
Item | HSCR(n = 90) | non-HSCR(n = 50) | P value |
Age (mo) | 7.2 ± 3.15 | 7.9 ± 2.07 | NS |
Serum total protein (g/L) | 68.8 ± 5.17 | 70.2 ± 4.29 | NS |
Serum albumin (g/L) | 48.2 ± 7.63 | 50.5 ± 6.19 | NS |
Hemoglobin (g/L) | 129.1 ± 10.07 | 131.9 ± 9.89 | NS |
Blood urea nitrogen (mmol/L) | 3.23 ± 1.01 | 2.91 ± 1.27 | NS |
Length (cm) | 66.2 ± 4.94 | 67.9 ± 5.18 | NS |
Weight (kg) | 7.8 ± 2.11 | 8.2 ± 2.75 | NS |
Basal metabolic index | 8.6% ± 0.04% | 9.1% ± 0.05% | NS |
Antigen | Primary antibody | Dilution | Applications |
Neuroligin-1 | Goat-anti-human polyclonal | 1/100 | Detect Nlgn-1 with immunofluorescence on LMMP |
Neuroligin-1 | Goat-anti-human polyclonal | 1/50 | Detect Nlgn-1 with Immunohistochemistry on paraffin-embedded sections |
Neuroligin-1 | Goat-anti-human polyclonal | 1/200 | Detect Nlgn-1 with Western-blot |
Glutamate | Mouse-anti-human monoclonal | 1/200 | Detect Glu with immunofluorescence on LMMP |
Glutamate | Mouse-anti-human monoclonal | 1/200 | Detect Glu with Immunohistochemistry on LMMP |
Glutamate | Mouse-anti-human monoclonal | 1/400 | Detect Nlgn-1 with Western-blot |
β-actin | Rat-anti-human polyclonal | 1/2000 | Western-blot internal reference |
Secondary antibody | Dilution | Applications | Source |
Donkey anti-goat Texas Red Secondary | 1/500 | Label Nlgn-1 with immunofluorescence | ZSGB-BIO China |
Goat anti-mouse FITC Secondary | 1/200 | Label Glu with immunofluorescence | ZSGB-BIO China |
Horseradish Peroxidase-conjugated goat-anti-rat IgG | 1/500 | Detect β-actin with Western-blot | SANTA CRUZ United States |
Horseradish Peroxidase-conjugated rabbit-anti-goat IgG | 1/1000 | Detect Nlgn-1 with Western-blot | SANTA CRUZ United States |
Horseradish Peroxidase-conjugated goat-anti-mouse IgG | 1/1000 | Detect Glu with Western-blot | SANTA CRUZ United States |
Primer | Primer sequence (5’→3’) | Annealing temperature (°C) | Product size (bp) |
Neuroligin-1 | F: GCAAGACCAGAGCAGAGACT | 59 | 314 |
R: CACCACCAAAGAATCCAATGTT | |||
β-actin | F: AGCGAGCATCCCCCAAAGTT | 60 | 285 |
R: GGGCACGAAGGCTCATCATT |
- Citation: Wang J, Du H, Mou YR, Niu JY, Zhang WT, Yang HC, Li AW. Abundance and significance of neuroligin-1 and glutamate in Hirschsprung’s disease. World J Gastroenterol 2015; 21(23): 7172-7180
- URL: https://www.wjgnet.com/1007-9327/full/v21/i23/7172.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i23.7172