BPG is committed to discovery and dissemination of knowledge
Evidence-Based Medicine
Copyright ©The Author(s) 2015.
World J Gastroenterol. Apr 28, 2015; 21(16): 5039-5048
Published online Apr 28, 2015. doi: 10.3748/wjg.v21.i16.5039
Table 1 Clinical data of the subjects in cohort I (292 subjects) and cohort II (90 subjects) n (%)
Clinical factorCohort ICohort II
Patient No.29290
Age in years, mean ± SD46.8 ± 16.037.8 ± 9.6
Male225 (77.1)46 (51.1)
HBeAg-positive162 (55.5)58 (64.4)
Liver disease No.C : CH : LC : HCCC : CH
66 : 33 : 67 : 12636 : 54
ALT [IU/liter (mean ± SD)]77.7 ± 153.4117.4 ± 226.5
Median of HBV-DNA (range)979.4 (0-6000)11.3 × 109 (100-15.1 × 109)2
Table 2 Primers and HybProbes developed to identify hepatitis B virus preS1 start codon deletion variants by real-time polymerase chain reaction
NameSequence (5'3')Tm (°C)1Target sequenceChannel
Forward primerHBV_sFGGGTCACCATATTCTTGGGAAC62.5203 - 224 bp of S gene
Reverse primerHBV_sRCGAATGCTCCCRCTCCTAC60.5 or 63.3203 - 224 bp of S gene
Anchor probeWT_AACAGAAAGATTCGTCCCCATGCCTTGTCGAGG -FL272.1
Sensor probeWT_SLC Red6403-TGGAAGACGGACCTCCCATG-PH63.4Wild type S gene640
Anchor probe18D_AGATTGGGAACAGAAAGATTCGTCCCCATGCC-FL70.3
Sensor probe18D_SLC Red6104-TCGAGGTTTGCTGTAGCT-PH559.918 bp deletion610
Anchor probe21D_ACCAGAGGATTGGGAACAGAAAGATTCGTCCCC-FL70.5
Sensor probe21D_SLC Red640-GCCTTGTCGAGTGCTGTAGC -PH64.721 bp deletion640
Anchor probe15D_AACAGAAAGATTCGTCCCCATGCCTTGTCGAGG -FL73.2
Sensor probe15D_SLC Red6706-TTGGTGCTGTAGCTCTT-PH5715 bp deletion670
Anchor probepreS1_AGATCCTTGTTGGGGTTGAAGTCCC-FL65.8
Sensor probepreS1_SLC Red6104-ATCTGGATTGTTTGAGTTGGCT-PH62.4PreS1610
Table 3 Sensitivity of fluorescence resonance energy transfer-based real-time polymerase chain reaction assay, according to the subjects’ clinical statuses n (%)
DiseasesNumber of tests positive/total
Cohort ICohort II
HCC109/125 (87.2)
LC59/69 (85.5)
CH33/33 (100)50/54 (92.6)
C63/66 (95.5)27/36 (75)
Total264/292 (90.4)77/90 (85.6)
Table 4 Ten types of polymorphism detected by fluorescence resonance energy transfer-based real-time polymerase chain reaction assay and their prevalences among the 341 detected subjects
Typesn (%)
WT only241 (70.7)
15 del only3 (0.9)
18 del only3 (0.9)
21 del only4 (1.2)
WT + 15 del16 (4.7)
WT + 18 del47 (13.8)
WT + 21 del6 (1.8)
WT + 15 del + 18 del18 (5.3)
WT + 18 del + 21 del2 (0.6)
WT + 15 del + 18 del + 21 del1 (0.3)
Total341
Table 5 Comparison of clinical data between subjects of cohort I and II with and without deletion variants n (%)
Clinical factorCohort I
Cohort II
Wild type (n = 192)Deletion (n = 72)P valueWild type (n = 49)Deletion (n = 28)P value
Age in years, mean ± SD46.3 ± 15.744.7 ± 17.80.47135.8 ± 8.939.1 ± 11.10.186
Male148 (77.1)52 (72.2)0.42320 (40.8)16 (57.1)0.235
HBeAg-positive98 (51.0)54 (75.0)< 0.00129 (69.2)26 (92.9)0.002
Liver disease (C : CH : LC : HCC)43 : 27 : 47 : 7520 : 6 : 12 : 3418 : 319 : 19
ALT [IU/liter (mean ± SD)]87.7 ± 182.454.4 ± 33.50.295125.5 ± 271.2120.9 ± 160.30.935
Median of HBV-DNA (range)797.7 (0-6000)11678.9 (0-6000)10.0138.3 × 108 (100-10.1 × 109)22.2 × 109 (2.3 × 103-15.1 × 109)20.049
Table 6 Comparison of the clinical data between the combined cohort I and II subjects with and without deletion and the prevalence of 3 types of deletion variants, according to their clinical statuses n (%)
Wild type (n = 241)Deletion (n = 100)21 del (n = 13)18 del (n = 70)15 del (n = 38)P value
Age in years, mean ± SD44.1 ± 15.243.1 ± 16.351.6 ± 15.742.0 ± 15.940.3 ± 14.80.564
Male168 (69.7)68 (68.0)6 (69.2)46 (65.7)24 (63.1)0.797
HBeAg-positive127 (52.7)80 (80.0)8 (61.5)58 (82.9)33 (86.8)< 0.001
Liver disease (C : CH : LC : HCC)61 : 58 : 47 : 7529 : 25 : 12 : 344 : 3 : 0 : 821 : 17 : 9 : 2312 : 13 : 5 : 8
ALT [IU/liter (mean ± SD)]96.8 ± 207.181.1 ± 111.263.2 ± 43.385.5 ± 128.389.0 ± 122.40.476
Table 7 Comparison of fluorescence resonance energy transfer-based real-time polymerase chain reaction vs direct sequencing protocol for detection of deletion variants n (%)
Direct sequencingResult for FRET-based real-time PCR
Only wild type (n = 13)1Mixed infection (n = 10)2
Only wild type13 (100)3
Mixed infection07 (70)