BPG is committed to discovery and dissemination of knowledge
Original Article
©2014 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 21, 2014; 20(47): 17839-17850
Published online Dec 21, 2014. doi: 10.3748/wjg.v20.i47.17839
Table 1 Antibody dilution, unmasking, incubation time, temperature, and immunodetection used for immunofluorescence
Antibody (source)Unmasking of antigensDilutionIncubationDetection system
NF-κB p65 (Neomarkers, United States)Citrate buffer pH 6.0, 95 °C, 10 min, water bath1:100018 h at 4 °CIF with Alexa Fluor 546 (Invitrogen, Germany) as secondary antibody
Table 2 Primer sequences for real-time reverse transcription-polymerase chain reaction
mRNAAccession No.Sense primer, 5'→3’Antisense primer, 5'→3’
18SNR_003278.1GTAACCCGTTGAACCCCATTCCATCCAATCGGTAGTAGCG
PPARaNM_001113418.1CCTTCCCTGTGAACTGACGCCACAGAGCGCTAAGCTGT
IL-1BNM_008361.3GAGAGCCTGTGTTTTCCTCCGAGTGCTGCCTAATGTCCC
TNFNM_013693.2CCATTCCTGAGTTCTGCAAAGGAGGTAGGAAGGCCTGAGATCTTATC
HMGCRNM_008255.2ATCCAGGAGCGAACCAAGAGAGCAGAAGCCCCAAGCACAAAC
SCD1NM_009127.4AGATCTCCAGTTCTTACACGACCACCTTTCATTTCAGGACGGATGTCT
CPT1aNM_013495.2CTCAGTGGGAGCGACTCTTCAGGCCTCTGTGGTACACGACAA
NOS2NM_010927.3CTCACTGGGACAGCACAGAAGATGTGGCCTTGTGGTGAA
PTGS/COX2XM_192868TGACCCCCAAGGCTCAAATATTGAACCCAGGTCCTCGCTTA
FASNNM_007988.3GGCTGCTACAAACAGACCATCACGGTAGAAAAGGCTCAGT
SREBF2NM_033218.1ACCTAGACCTCGCCAAAGGTCGGATCACATTCCAGGAGA
Table 3 Scoring system for hepatocellular iron and nuclear factor kappa B-p65 nuclear translocation
Scoring systemAssessed by
Hepatocellular iron
Score 0No granulesPrussian blue
Score 1Zone 1, granules seen at × 40
Score 2Granules seen at × 20
Score 3Granules seen at × 10
Score 4Granules seen at × 10 in zone 1 and 2
Table 4 Liver weight and serum parameters of p62 transgenic and wild-type mice fed a methionine-choline deficient diet or control diet for two and four weeks
2 wk
4 wk
ctrl
MCD
ctrl
MCD
wttgwttgwttgwttg
Number of animals1010121210101212
Relative liver weight (% of body weight)4.8 ± 0.14.6 ± 0.13.4 ± 0.1c4.0 ± 0.2ace4.2 ± 014.1 ± 0.13.4 ± 0.1c3.5 ± 0.2ce
Serum ALT (U/L)289 ± 83233 ± 20418 ± 36c469 ± 73ce189 ± 38222 ± 25235 ± 40209 ± 46
Serum AST (U/L)1568 ± 2241535 ± 1622404 ± 125c2544 ± 207ce1845 ± 2041712 ± 2532813 ± 286c3057 ± 346c
Serum triglycerides (mg/dL)244 ± 19219 ± 17107 ± 5c128 ± 11ce211 ± 18203 ± 2195 ± 7c106 ± 5ce
Serum HDL (mg/dL)94 ± 698 ± 424 ± 2c21 ± 4ce112 ± 8119 ± 815 ± 2c18 ± 2ce
Serum glucose (mg/dL)234 ± 27179 ± 1567 ± 10c59 ± 7ce193 ± 13253 ± 3659 ± 7c40 ± 5ace
Table 5 Gas-chromatography mass-spectrometry fatty acid analyses of mice fed the methionine-choline deficient or control diet for two weeks
Fatty acidctrl wtctrl tgP value1MCD wtMCD tgP value2P value3
14:00.25 ± 0.040.25 ± 0.050.9700.24 ± 0.040.43 ± 0.040.0030.005
15:00.01 ± 0.0030.01 ± 0.0030.1130.02 ± 0.010.05 ± 0.010.0350.002
16:017.23 ± 0.7916.08 ± 1.430.62317.16 ± 1.6323.85 ± 1.650.0060.0033
16:11.69 ± 0.291.51 ± 0.300.5700.57 ± 0.101.13 ± 0.120.0050.138
17:00.11 ± 0.010.06 ± 0.010.0210.23 ± 0.030.34 ± 0.030.0100.0001
17:10.02 ± 0.010.01 ± 0.010.0460.003 ± 0.0030.01 ± 0.010.5140.117
18:012.64 ± 0.579.41 ± 0.810.00613.08 ± 0.9718.15 ± 1.000.00140.0009
18:120.13 ± 2.5117.98 ± 2.070.67824.11 ± 1.2839.66 ± 3.270.0010.0009
18:217.88 ± 0.8716.42 ± 1.600.24123.90 ± 2.1536.28 ± 6.340.0400.004
18:30.23 ± 0.050.27 ± 0.100.5711.50 ± 0.282.99 ± 0.460.0030.00009
20:00.22 ± 0.050.10 ± 0.030.0450.14 ± 0.030.33 ± 0.050.00070.138
20:10.40 ± 0.030.30 ± 0.040.0450.81 ± 0.141.99 ± 0.270.0020.00009
20:20.45 ± 0.040.53 ± 0.060.3851.67 ± 0.172.94 ± 0.250.00060.00009
20:31.09 ± 0.090.89 ± 0.140.1862.87 ± 0.375.15 ± 0.440.00060.00009
20:413.69 ± 0.5810.37 ± 0.800.01116.49 ± 1.1523.20 ± 1.810.0060.00015
22:00.59 ± 0.110.29 ± 0.070.0310.31 ± 0.030.50 ± 0.030.00070.921
22:10.01 ± 0.0030.003 ± 0.0030.3870.01 ± 0.010.04 ± 0.010.0910.129
22:40.57 ± 0.050.51 ± 0.080.2734.24 ± 0.486.25 ± 0.560.00360.00009
22:64.72 ± 0.283.82 ± 0.290.05412.08 ± 0.9014.06 ± 1.050.2140.00009
23:00.08 ± 0.010.04 ± 0.0040.00030.08 ± 0.010.10 ± 0.010.1940.223
24:00.42 ± 0.020.31 ± 0.020.0030.45 ± 0.020.63 ± 0.050.00130.0009


Write to the Help Desk