Changes in circulating Foxp3+ regulatory T cells and interleukin-17-producing T helper cells during HBV-related acute-on-chronic liver failure

Table 1 Clinical characteristics of patients with hepatitis B virus-related acute-on-chronic liver failure

No.	Age (yr)	Sex	Onset						Peak						Recovery
			Week after clinical onset	ALT (U/L)	TBIL (μmol/L)	HBV DNA(Log 10 copies/mL)	PTA	MELD-Na	Week after clinical onset	ALT(U/L)	TBIL(μmol/L)	HBV DNA(Log 10 copies/mL )	PTA	MELD-Na	Week after clinical onset	ALT(U/L)	TBIL(μmol/L)	HBV DNA(Log 10 copies/mL)	PTA	MELD-Na
1	58	M	1	112	497.3	5.69	48.01%	24.70	2	72	239.5	4.58	51.36%	22.56	7	59	152.3	3.21	50.38%	21.19
2	48	M	1	65	309.5	5.21	38.30%	18.38	2	64	267.5	4.25	45.56%	20.45	8	68	152.8	3.21	41.97%	15.04
3	45	M	1	1002	400.5	3.67	21.65%	26.86	3	316	576.8	2.08	16.06%	58.53	Died
4	50	F	1	302	520.1	6.36	16.35%	52.47	2	Died
5	59	M	1	435	170.6	5.22	40.36%	16.84	3	62	60.2	4.15	60.13%	11.99	5	44	45.6	4	62.26%	10.25
6	50	M	2	145	620.0	3.29	46.40%	31.14	3	165	613.7	3.29	46.81%	27.99	7	129	546.3	3.29	36.72%	30.55
7	38	M	1	92	449.5	4.57	24.24%	26.48	2	89	481.9	3.29	22.78%	25.77	6	68	456.6	3.04	28.57%	26.08
8	30	M	1	504	293.6	7.14	42.65%	21.78	3	148	403.4	3.12	42.65%	25.07	8	59	350.0	3.27	53.44%	24.05
9	42	M	1	282	439.1	5.88	42.31%	18.93	2	151	449.6	3.29	37.50%	21.70	8	83	471.9	3.12	34.78%	26.08
10	61	M	1	81	465.6	4.37	27.53%	29.51	2	61	405.0	3.11	27.53%	32.25	7	33	174.0	2.54	45.99%	15.93
11	44	M	2	53	599.8	2.67	28.12%	25.36	3	58	381.5	2.23	27.53%	46.89	8	46	297.0	2.12	22.02%	37.87
12	55	F	1	35	182.8	4.30	25.78%	20.31	2	46	208.5	ND	27.24%	20.78	7	60	197.8	2.23	23.70%	22.58
13	52	M	1	213	381.1	5.89	10.96%	39.84	2	584	540.2	ND	4.70%	62.03	Died
14	48	M	1	355	364.7	6.07	32.43%	25.63	2	63	546.2	2.12	29.20%	29.60	8	75	127.0	1.25	49.44%	24.03
15	45	F	1	21	508.8	3.35	40.99%	33.77	2	31	481.2	2.98	44.07%	38.17	8	22	158.8	2.12	59.46%	15.23
16	30	M	1	93	395.0	3.19	18.67%	29.42	2	86	353.8	3.19	19.14%	36.92	8	76	169.9	2.86	21.84%	12.40
17	53	M	2	138	541.5	2.67	30.73%	28.79	3	107	639.6	2.32	27.53%	50.07	Died
18	33	M	1	138	216.0	5.68	47.212%	22.43	2	63	259.2	4.11	74.58%	16.17	6	89	132.9	2.89	89.80%	10.38

Table 2 T helper type 17 and T regulatory differentiation-related cytokines

Genes	GenBank accession number	Primers (5' to 3')	Reported function
IL-1β	NM_000576	Forward: GCTGATGGCCCTAAACAGATGAA	Induce human Th17 polarization[17]
		Reverse: TGAAGCCCTTGCTGTAGTGGTG
IL-6	NM_000600	Forward: AAGCCAGAGCTGTGCAGATGAGTA	Induce human Th17 polarization[17]
		Reverse: TGTCCTGCAGCCACTGGTTC
IL-23/p19	NM_016584	Forward: GCAGCCTGAGGGTCACCACT	Unique subunit of IL-23
		Reverse: GGCGGCTACAGCCACAAA
IL-17A	NM_002190	Forward: TGTCCACCATGTGGCCTAAGAG	Main effective cytokine of Th17 cells[7]
		Reverse: GTCCGAAATGAGGCTGTCTTTGA
TGF-β1	NM_000660	Forward: AGCGACTCGCCAGAGTGGTTA	Induce mouse Th17 and Treg polarization, suppress human Th17 polarization[9,10,17]
		Reverse: GCAGTGTGTTATCCCTGCTGTCA
IL-2	NM_000586	Forward: CAACTCCTGTCTTGCATTGCACTAA	Induce human and mouse Treg polarization[10]
		Reverse: AATGTGAGCATCCTGGTGAGTTTG
FoxP3	NM_014009	Forward: GTTCACACGCATGTTTGCCTTC	Master regulatory transcription factors of Treg lineage[21]
		Reverse: CACAAAGCACTTGTGCAGACTCAG

Table 3 Correlations between clinical characteristics and host immune data during the onset, peak, and recovery phases of hepatitis B virus-related acute-on-chronic liver failure

		Onset								Peak								Recovery
		Th17		Treg		Treg/Th17		IL-17		Th17		Treg		Treg/Th17		IL-17		Th17		Treg		Treg/Th17		IL-17
		r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value	r	P-value
Total patients	ALT	0.17	0.49	-0.02	0.92	-0.004	0.98	-0.17	0.48	-0.20	0.44	0.11	0.68	0.42	0.10	-0.56	0.02	-0.17	0.56	-0.33	0.24	0.00	1.00	-0.24	0.41
	TBIL	0.06	0.81	-0.21	0.38	-0.20	0.41	-0.28	0.25	0.04	0.88	-0.11	0.68	-0.04	0.88	-0.30	0.23	-0.30	0.29	-0.15	0.59	-0.09	0.76	-0.36	0.19
	MELD-Na	0.09	0.71	-0.02	0.91	-0.18	0.46	-0.01	0.96	0.02	0.95	-0.09	0.74	0.07	0.79	-0.06	0.82	-0.50	0.06	-0.01	0.98	0.15	0.60	-0.27	0.34
Survivors	ALT	-0.11	0.71	0.17	0.56	0.25	0.40	-0.12	0.68	-0.42	0.15	0.12	0.73	0.58	0.04	-0.53	0.06	-0.19	0.52	-0.17	0.57	0.19	0.53	-0.29	0.32
	TBIL	-0.17	0.57	0.09	0.75	0.14	0.63	-0.33	0.26	-0.29	0.34	-0.34	0.25	0.01	0.99	-0.14	0.65	-0.35	0.23	0.05	0.85	0.06	0.83	-0.42	0.14
	MELD-Na	-0.54	0.05	0.008	0.98	0.30	0.32	0.01	0.96	-0.08	0.80	-0.33	0.27	-0.10	0.75	0.24	0.44	-0.55	0.05	0.18	0.54	0.31	0.29	-0.32	0.27

ALT: Alanine aminotransferase; TBIL: Total bilirubin; PTA: Prothrombin activity; MELD-Na: Model for end-stage liver diseases and sodium; Th17: Interleukin-17-producing T helper cells; Treg: Foxp3⁺ regulatory T cell; Treg/Th17: Ratio of Treg to Th17 cells. Data were analyzed by Spearman correlation test.

Table 4 Predictive value of Foxp3⁺ regulatory T cell and interleukin-17-producing T helper cells in hepatitis B virus-related acute-on-chronic liver failure patient survival

Variables	Area	Standard error	Asymptotic sign	95%CI
				Low boundary	Upper boundary
Treg frequency at onset	0.577	0.163	0.622	0.258	0.896
Th17 frequency at onset	0.108	0.081	0.012	0.000	0.266
Ratio of Treg to Th17 at onset	0.846	0.100	0.027	0.650	1.000
Serum IL-17 level at onset	0.554	0.136	0.730	0.288	0.820
Treg frequency at peak	0.523	0.166	0.882	0.197	0.849
Th17 frequency at peak	0.462	0.168	0.805	0.132	0.791
Ratio of Treg to Th17 at peak	0.585	0.160	0.588	0.270	0.899
Ratio of Treg to Th17 change from onset to peak	0.308	0.132	0.218	0.049	0.566
Serum IL-17 level at peak	0.785	0.108	0.068	0.573	0.997