Copyright
©2014 Baishideng Publishing Group Co.
World J Gastroenterol. Mar 28, 2014; 20(12): 3327-3334
Published online Mar 28, 2014. doi: 10.3748/wjg.v20.i12.3327
Published online Mar 28, 2014. doi: 10.3748/wjg.v20.i12.3327
Table 1 Baseline demographic and clinical characteristics of the inflammatory bowel disease patients n (%)
Diagnosis | CD (n = 146) | UC (n = 73) |
Gender | ||
Male:female | 61:85 | 30:43 |
Age at diagnosis | ||
< 40 (A1):40 (A2) | 111:35 | 38:35 |
Disease location CD | ||
Terminal ileum (L1) | 30 (20.5) | |
Colon (L2) | 42 (28.8) | |
Ileocolon (L3) | 65 (44.5) | |
Upper GI (L4) | 9 (6.2) | |
Disease behavior | ||
NS/NP (B1) | 53 (36.3) | |
Stricturing (B2) | 45 (30.8) | |
Penetrating (B3) | 48 (32.9) | |
Perianal disease | ||
Yes:no | 38:108 (26.1) | |
Disease location UC | ||
Pancolitis | 38 (52.1) | |
Non-pancolitis | 35 (47.9) | |
Disease activity | ||
Moderate/severe | 28 (19.2) | 15 (20.5) |
Mild/Remission | 118 (80.8) | 58 (79.5) |
Surgery because of IBD | ||
Yes:no | 48:98 (32.9) | 0:73 (0) |
Chronic steroid use | ||
Yes:no | 26:120 (17.8) | 10:63 (13.7) |
Side effects of medication | ||
Yes:no | 43:103 (29.4) | 18:55 (24.6) |
Azathioprine | ||
Yes:no | 138:8 (94.5) | 44:29 (60.3) |
Table 2 Primer sequences used to identify the G238C, G460A, and A719G polymorphisms of the thiopurine-methyl-transferase gene
Name | Sequence | Product size |
P2W reverse | 5’ GTA TGA TTT TAT GACGGT TG 3’ | 254 |
P2M reverse | 5’ GTA TGA TTT TATGCA GGT TTC 3’ | |
P2C forward | 5’ TAA ATAGGAACC ATCGGA CAC 3’ | |
460 forward | 5’ TCC CCA AAT CAT AAC AGA GTG 3’ | 375 |
460 reverse | 5’ CTAGAACCCAGAAAAAGTATAG3’ | |
719 forward | 5’ CGT TGT CTT GAG AAG GTT GA 3’ | 175 |
719 reverse | 5’ CAT TAC ATT TTC AGG CTT TAG CAT A 3’ |
Table 3 Allelic frequencies of C238G, G460, and A719G in patients with inflammatory bowel disease
Polymorphism | CHz | HTz | RHz | n | Allelic frequency | χ2 | P-value | |
CD | ||||||||
C238G | C:C | C:G | G:G | C | G | |||
Observed | 141 | 5 | 0 | 146 | 0.98 | 0.02 | 0.04 | 0.83 |
Expected | 141 | 5 | 0 | |||||
G460A/A719G | G:G/A:A | G:A/A:G | A/A:G/G | G/A | A/G | |||
Observed | 137 | 9 | 0 | 146 | 0.97 | 0.03 | 0.14 | 0.70 |
Expected | 137 | 9 | 0 | |||||
A719G | A:A | A:G | G:G | A | G | |||
Observed | 128 | 18 | 0 | 146 | 0.94 | 0.06 | 0.63 | 0.42 |
Expected | 128 | 16 | 1 | |||||
UC | ||||||||
C238G | C:C | C:G | G:G | C | G | |||
Observed | 71 | 2 | 0 | 73 | 0.99 | 0.01 | 0.01 | 0.90 |
Expected | 71 | 2 | 0 | |||||
G460A/A719G | G:G/A:A | G:A/A:G | A/A:G/G | G/A | A/G | |||
Observed | 70 | 3 | 0 | 73 | 0.98 | 0.02 | 0.03 | 0.85 |
Expected | 70 | 3 | 0 | |||||
A719G | A:A | A:G | G:G | A | G | |||
Observed | 66 | 7 | 0 | 73 | 0.95 | 0.05 | 0.18 | 0.66 |
Expected | 66 | 7 | 0 |
Table 4 Analysis of thiopurine-methyl-transferase gene polymorphisms in patients with inflammatory bowel disease n (%)
TPMT SNP | CHz | HTz | RHz | P-value |
C238G | C:C | C:G | G:G | |
CD (n = 143) | 137 (95.8) | 6 (4.2) | 0 | 0.722 |
UC (n = 71) | 69 (97.2) | 2 (2.8) | 0 | |
G460A/A719G | G:G/A:A | G:A/A:G | A/A:G/G | |
CD (n = 126) | 118 (93.7) | 8 (6.3) | 0 | 0.750 |
UC (n = 69) | 66 (95.7) | 3 (4.3) | 0 | |
A719G | A:A | A:G | G:G | |
CD (n = 135) | 122 (90.4) | 13 (9.6) | 0 | 0.612 |
UC (n = 71) | 66 (93.0) | 5 (7.0) | 0 |
Table 5 Association between the thiopurine-methyl-transferase polymorphisms and adverse effects in patients with inflammatory bowel disease n (%)
C238G | G460A/A719G | A719G | ||||
Adverse effect | CHz | HTz | CHz | HTz | CHz | HTz |
Crohn’s disease | 35/143 (24.5) | 30/126 (23.8) | 33/135 (24.4) | |||
Myelosuppression | 0 | 0 | 0 | 0 | 0 | 0 |
Neutropenia | 3 (2.1) | 0 | 2 (1.6) | 0 | 2 (1.5) | 0 |
Flu-like symptoms | 3 (2.1) | 0 | 3 (2.4) | 0 | 3 (2.2) | 0 |
Nausea/vomiting | 12 (8.4) | 0 | 9 (7.1) | 1 (0.8) | 11 (8.1) | 1 (0.7) |
Allergy/dermatitis | 1 (0.7) | 0 | 2 (1.6) | 0 | 2 (1.5) | 0 |
Hepatotoxicity | 5 (3.5) | 1 (0.7) | 5 (4.0) | 0 | 5 (3.7) | 0 |
Amylase/lipase elevation | 6 (4.2) | 2 (1.4) | 6 (4.7) | 0 | 3 (2.2) | 4 (2.9) |
Pancreatitis | 1 (0.7) | 1 (0.7) | 2 (1.6) | 0 | 2 (1.5) | 0 |
Ulcerative colitis | 14/71 (19.7) | 18/68 (26.5) | 14/71 (19.7) | |||
Myelosuppression | 0 | 0 | 0 | 0 | 0 | 0 |
Neutropenia | 0 | 0 | 0 | 0 | 0 | 0 |
Flu-like symptoms) | 1 (1.4) | 0 | 1 (1.5) | 0 | 1 (1.4) | 0 |
Nausea/vomiting | 4 (5.6) | 0 | 3 (4.4) | 0 | 3 (4.2) | 0 |
Allergy/dermatitis | 3 (4.2) | 2 (2.8) | 3 (4.4) | 0 | 2 (2.8) | 0 |
Hepatotoxicity | 0 | 0 | 0 | 0 | 0 | 0 |
Amylase/lipase elevation | 2 (2.8) | 1 (1.4) | 3 (4.4) | 0 | 3 (4.2) | 0 |
Pancreatitis | 0 | 1 (1.4) | 1 (1.5) | 0 | 1 (1.4) | 0 |
- Citation: Carvalho ATP, Esberard BC, Fróes RSB, Rapozo DCM, Grinman AB, Simão TA, Santos JCVC, Carneiro AJV, Ribeiro-Pinto LF, Souza HSP. Thiopurine-methyltransferase variants in inflammatory bowel disease: Prevalence and toxicity in Brazilian patients. World J Gastroenterol 2014; 20(12): 3327-3334
- URL: https://www.wjgnet.com/1007-9327/full/v20/i12/3327.htm
- DOI: https://dx.doi.org/10.3748/wjg.v20.i12.3327