Thiopurine-methyltransferase variants in inflammatory bowel disease: Prevalence and toxicity in Brazilian patients

Table 1 Baseline demographic and clinical characteristics of the inflammatory bowel disease patients n (%)

Diagnosis	CD (n = 146)	UC (n = 73)
Gender
Male:female	61:85	30:43
Age at diagnosis
< 40 (A1):40 (A2)	111:35	38:35
Disease location CD
Terminal ileum (L1)	30 (20.5)
Colon (L2)	42 (28.8)
Ileocolon (L3)	65 (44.5)
Upper GI (L4)	9 (6.2)
Disease behavior
NS/NP (B1)	53 (36.3)
Stricturing (B2)	45 (30.8)
Penetrating (B3)	48 (32.9)
Perianal disease
Yes:no	38:108 (26.1)
Disease location UC
Pancolitis		38 (52.1)
Non-pancolitis		35 (47.9)
Disease activity
Moderate/severe	28 (19.2)	15 (20.5)
Mild/Remission	118 (80.8)	58 (79.5)
Surgery because of IBD
Yes:no	48:98 (32.9)	0:73 (0)
Chronic steroid use
Yes:no	26:120 (17.8)	10:63 (13.7)
Side effects of medication
Yes:no	43:103 (29.4)	18:55 (24.6)
Azathioprine
Yes:no	138:8 (94.5)	44:29 (60.3)

CD: Crohn’s disease; UC: Ulcerative colitis; IBD: Inflammatory bowel disease.

Table 2 Primer sequences used to identify the G238C, G460A, and A719G polymorphisms of the thiopurine-methyl-transferase gene

Name	Sequence	Product size
P2W reverse	5’ GTA TGA TTT TAT GACGGT TG 3’	254
P2M reverse	5’ GTA TGA TTT TATGCA GGT TTC 3’
P2C forward	5’ TAA ATAGGAACC ATCGGA CAC 3’
460 forward	5’ TCC CCA AAT CAT AAC AGA GTG 3’	375
460 reverse	5’ CTAGAACCCAGAAAAAGTATAG3’
719 forward	5’ CGT TGT CTT GAG AAG GTT GA 3’	175
719 reverse	5’ CAT TAC ATT TTC AGG CTT TAG CAT A 3’

Table 3 Allelic frequencies of C238G, G460, and A719G in patients with inflammatory bowel disease

Polymorphism	CHz	HTz	RHz	n	Allelic frequency		χ2	P-value
CD
C238G	C:C	C:G	G:G		C	G
Observed	141	5	0	146	0.98	0.02	0.04	0.83
Expected	141	5	0
G460A/A719G	G:G/A:A	G:A/A:G	A/A:G/G		G/A	A/G
Observed	137	9	0	146	0.97	0.03	0.14	0.70
Expected	137	9	0
A719G	A:A	A:G	G:G		A	G
Observed	128	18	0	146	0.94	0.06	0.63	0.42
Expected	128	16	1
UC
C238G	C:C	C:G	G:G		C	G
Observed	71	2	0	73	0.99	0.01	0.01	0.90
Expected	71	2	0
G460A/A719G	G:G/A:A	G:A/A:G	A/A:G/G		G/A	A/G
Observed	70	3	0	73	0.98	0.02	0.03	0.85
Expected	70	3	0
A719G	A:A	A:G	G:G		A	G
Observed	66	7	0	73	0.95	0.05	0.18	0.66
Expected	66	7	0

CD: Crohn’s disease; UC: Ulcerative colitis; CHz: Common homozygous; HTz: Heterozygous; RHz: Rare homozygous. Data were analyzed using Fisher’s exact test. If P < 0.05-not consistent with HWE. Not accurate if < 5 individuals in any genotype group.

Table 4 Analysis of thiopurine-methyl-transferase gene polymorphisms in patients with inflammatory bowel disease n (%)

TPMT SNP	CHz	HTz	RHz	P-value
C238G	C:C	C:G	G:G
CD (n = 143)	137 (95.8)	6 (4.2)	0	0.722
UC (n = 71)	69 (97.2)	2 (2.8)	0
G460A/A719G	G:G/A:A	G:A/A:G	A/A:G/G
CD (n = 126)	118 (93.7)	8 (6.3)	0	0.750
UC (n = 69)	66 (95.7)	3 (4.3)	0
A719G	A:A	A:G	G:G
CD (n = 135)	122 (90.4)	13 (9.6)	0	0.612
UC (n = 71)	66 (93.0)	5 (7.0)	0

Data were analyzed using Fisher’s exact test. CHz: Common homozygous; HTz: Heterozygous; RHz: Rare homozygous. CD: Crohn’s disease; UC: Ulcerative colitis; TPMT: Thiopurine-methyl-transferase.

Table 5 Association between the thiopurine-methyl-transferase polymorphisms and adverse effects in patients with inflammatory bowel disease n (%)

	C238G		G460A/A719G		A719G
Adverse effect	CHz	HTz	CHz	HTz	CHz	HTz
Crohn’s disease	35/143 (24.5)		30/126 (23.8)		33/135 (24.4)
Myelosuppression	0	0	0	0	0	0
Neutropenia	3 (2.1)	0	2 (1.6)	0	2 (1.5)	0
Flu-like symptoms	3 (2.1)	0	3 (2.4)	0	3 (2.2)	0
Nausea/vomiting	12 (8.4)	0	9 (7.1)	1 (0.8)	11 (8.1)	1 (0.7)
Allergy/dermatitis	1 (0.7)	0	2 (1.6)	0	2 (1.5)	0
Hepatotoxicity	5 (3.5)	1 (0.7)	5 (4.0)	0	5 (3.7)	0
Amylase/lipase elevation	6 (4.2)	2 (1.4)	6 (4.7)	0	3 (2.2)	4 (2.9)
Pancreatitis	1 (0.7)	1 (0.7)	2 (1.6)	0	2 (1.5)	0
Ulcerative colitis	14/71 (19.7)		18/68 (26.5)		14/71 (19.7)
Myelosuppression	0	0	0	0	0	0
Neutropenia	0	0	0	0	0	0
Flu-like symptoms)	1 (1.4)	0	1 (1.5)	0	1 (1.4)	0
Nausea/vomiting	4 (5.6)	0	3 (4.4)	0	3 (4.2)	0
Allergy/dermatitis	3 (4.2)	2 (2.8)	3 (4.4)	0	2 (2.8)	0
Hepatotoxicity	0	0	0	0	0	0
Amylase/lipase elevation	2 (2.8)	1 (1.4)	3 (4.4)	0	3 (4.2)	0
Pancreatitis	0	1 (1.4)	1 (1.5)	0	1 (1.4)	0

CHz: Common homozygous; HTz: Heterozygous.