©2013 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 14, 2013; 19(22): 3404-3414
Published online Jun 14, 2013. doi: 10.3748/wjg.v19.i22.3404
Published online Jun 14, 2013. doi: 10.3748/wjg.v19.i22.3404
Table 1 Clinical and demographic features of ulcerative colitis patients and controls n (%)
| Feature | UC (n = 26) | Control (n = 14) |
| Sex (F/M) | 11 (42.30)/15 (57.69) | 7 (50)/7(50) |
| Age at diagnosis (yr), mean ± SD | 38.35 ± 11.49 | 35.00 ± 14.14 |
| 15-40 | 18 (69.23) | 8 (57.14) |
| > 40 | 8 (30.76) | 6 (42.85) |
| Disease behavior | ||
| Severe | 12 (46.15) | - |
| Moderate | 6 (23.07) | - |
| Remission | 8 (30.76) | - |
| Disease extent | ||
| Proctitis | 4 (15.38) | - |
| Left sided colitis | 6 (23.00) | - |
| Pancolitis | 6 (23.00) | - |
| None of the above | 10 (38.46) | - |
| Smoking history | ||
| Yes | 3 (11.53) | 2 (14.28) |
| No | 23 (88.46) | 12 (85.70) |
| Treatment history | ||
| Immunosuppressant | 16 (61.53) | - |
| Steroids | 14 (53.84) | - |
| Appendectomy Y/N | 4 (15.38)/22 (84.61) | 0/14 |
| Family history Y/N | 2 (7.69)/24 (92.30) | 0/14 |
Table 2 Probes and oligonucleotides employed in the study
| Primer or probe | Target (phylogenetic group) | Sequence (5’-3’) from 16S rRNA gene | Used in FISH-flow cytometry or qPCR | Ref. |
| NON338 | No bacteria | ACATCCTACGGGAGGC | Probe1 | [21] |
| EUB338 | Most bacteria | GCTGCCTCCCGTAGGAGT | Probe1 | [20] |
| Erec 482 | C. coccoides/E.rectale cluster | GCTTCTTAGTCARGTACCG | Probe1 | [34] |
| Clep 1156 | Clostridium leptum subgroup | GTTTTRTCAACGGCAGTC | Probe1 | [35] |
| Fpra-655 | F. prausnitzii | CGCCTACCTCTGCACTAC | Probe1 | [16] |
| Rint-623 | R. intestinalis subcluster | TTCCAATGCAGTACCGGG | Probe1 | [16] |
| Ehal-057 | E. halliii L2-7/E. halliii | TTGCACTGCCACCTACGC | Probe1 | [16] |
| Cp1 | Competitor 1 | GRTTTRTCAYCGGCAGTC | Competitor1 | [23] |
| Cp2 | Competitor 1 | GTVTTRTCBACGGCAGTC | Competitor1 | [23] |
| H1174 | Helper oligonucleotide | TTGACGTCRTCCCCACCTTCCTCC | Helper1 | [23] |
| H1129 | Helper oligonucleotide | TAGAGTGMTCTTGCGTA | Helper1 | [23] |
| H1090 | Helper oligonucleotide | GGTTGCGCTCGTTGCGGGACTTAA | Helper1 | [23] |
| H750 | Helper oligonucleotide | TCGHGCCTCAGCGTCAG | Helper1 | [23] |
| H122 | Helper oligonucleotide | GAAGGCAGGTTACTCACGC | Helper1 | [23] |
| Clep FP | C. leptum subgroup | CGTCAGCTCGTGTCGTGAGAT | Primer set2 | [36] |
| Clep RP | CGTCATCCCCACCTTCCTCC | |||
| C.cocci FP | C. coccoides subgroup | GCCACATTGGGACTGAGA | Primer set2 | [36] |
| C.cocci RP | GCTTCTTAGTCAGGTACCG | |||
| Fpraus FP | F. prausnitzii | GATGGCCTCGCGTCCGATTAG | Primer set2 | [37] |
| Fpraus RP | CCGAAGACCTTCTTCCTC | |||
| Rint FP | Roseburia/E. rectale cluster | CKGCAAGTCTGATGTGAAAG | Primer set2 | This study |
| Rint RP | GCGGGTCCCCGTCAATTCC | |||
| Ehal FP | E. hallii L2-7/E. hallii members | GCGTAGGTGGCAGTGCAA | Primer set2 | [38] |
| Ehal RP | GCACCGRAGCCTATACGG |
Table 3 Accession number of reference strain used in the study
| Bacteria | Source | Accession No. |
| C. leptum | Healthy human fecal sample | AM042697 |
| F. prausnitzii | Healthy human fecal sample | JX556686 |
| R. intestinalis | Healthy human fecal sample | JX556688 |
| E. hallii | Healthy human fecal sample | JX556687 |
Table 4 Enumeration of butyrate producers in fecal samples through fluorescent in situ hybridization-flow cytometry (mean ± SE)
| Cluster or species | Out of total microbiota | Species | Out of respective cluster |
| Control fecal samples | |||
| C. coccoides cluster | 25.69% ± 1.62% | R. intestinalis | 14.48% ± 1.52% |
| E. hallii | 5.93% ± 0.54% | ||
| C. leptum cluster | 13.74% ± 1.05% | F. prausnitzii | 11.66% ± 1.55% |
| R .intestinalis1 | 3.71% ± 0.39% | ||
| E. hallii1 | 1.52% ± 0.13% | ||
| F. prausnitzii1 | 1.60% ± 0.21% | ||
| UC fecal samples (moderate) | |||
| C. coccoides cluster | 12.70% ± 4.60% | R. intestinalis | 10.00% ± 2.25% |
| E. hallii | 4.03% ± 0.3% | ||
| C. leptum cluster | 6.40% ± 3.40% | F. prausnitzii | 7.5% ± 2.3% |
| R .intestinalis1 | 1.27% ± 0.10% | ||
| E. hallii1 | 0.51% ± 0.01% | ||
| F. prausnitzii1 | 0.48% ± 0.14% | ||
| UC fecal samples (severe) | |||
| C. coccoides cluster | 9.80% ± 2.40% | R. intestinalis | 9% ± 1.83% |
| E. hallii | 4.2% ± 0.2% | ||
| C. leptum cluster | 6.20% ± 1.80% | F. prausnitzii | 6.01% ± 1.6% |
| R .intestinalis1 | 0.82% ± 0.04% | ||
| E. hallii1 | 0.41% ± 0.01% | ||
| F. prausnitzii1 | 0.37% ± 0.02% | ||
| UC fecal samples (remission) | |||
| C. coccoides cluster | 12.99% ± 2.65% | R. intestinalis | 11.40% ± 1.83% |
| E. hallii | 5.07% ± 0.6% | ||
| C. leptum cluster | 7.89% ± 1.50% | F. prausnitzii | 7.40% ± 2.32% |
| R .intestinalis1 | 1.48% ± 0.04% | ||
| E. hallii1 | 0.65% ± 0.01% | ||
| F. prausnitzii1 | 0.58% ± 0.03% | ||
- Citation: Kumari R, Ahuja V, Paul J. Fluctuations in butyrate-producing bacteria in ulcerative colitis patients of North India. World J Gastroenterol 2013; 19(22): 3404-3414
- URL: https://www.wjgnet.com/1007-9327/full/v19/i22/3404.htm
- DOI: https://dx.doi.org/10.3748/wjg.v19.i22.3404