©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 7, 2012; 18(5): 425-434
Published online Feb 7, 2012. doi: 10.3748/wjg.v18.i5.425
Published online Feb 7, 2012. doi: 10.3748/wjg.v18.i5.425
Table 1 The sequence of primers used and the target region of cell division-related gene A amplified with combination of primers
| Primers | Sequence (5’-3’) | Reference | Combination of primers | Target region of cell division-related gene A |
| P1 (forward) | TGAAGCACACGAAAGGA | 17 | P1-P3 | N-terminal to central |
| P3 (reverse) | CATGCTCTAAAATCGTCG | 17 | P1-P3J | N-terminal to central |
| P3J (reverse) | ATCACCACGATCAGTCTG | This study | P3-P4 | Central |
| P4 (forward) | TTTTGAGATCGGTGAAGC | 17 | P3J-P4J | Central |
| P4J (forward) | AACCACACGCTCATTTGC | This study | P4-P9J | Central to C-terminal |
| P9J (reverse) | GCTGAAAGGCCTGAATTCAG | This study | P4J-P9J | Central to C-terminal |
Table 2 Helicobacter pylori cell division-related gene A status (positive or negative) and genotype (allele type) in clinical isolates n (%)
Table 3 Comparison of cell division-related gene A status and genotype (allete type) between antrum and corpus isolates in 29 American patients
| cdrA status1 | cdrA genetype (allele type) | |||||
| cdrA positive (6 cases) | Same2: 1 | Antrum (+)3 | Antrum | Corpus | ||
| Corpus (+) | Identical4: 1 | Type II | Type II | |||
| Difference: 5 | Antrum (+) | Difference: 5 | 4 | Type II | Type III | |
| Corpus (-) | 1 | Type II | Type IV | |||
| cdrA negative (23 cases) | Same: 22 | Antrum (-) | Identical: 16 | 5 | Type III | Type III |
| Corpus (-) | 11 | Type IV | Type IV | |||
| Difference: 1 | Antrum (-) | Difference: 7 | 4 | Type III | Type IV | |
| Corpus (+) | 2 | Type IV | Type III | |||
| 1 | Type IV | Type II | ||||
| Total (%) | Same: 23 (79) | Same: 17 (59) | ||||
| Difference: 6 (21) | Difference: 12 (41) | |||||
-
Citation: Takeuchi H, Zhang YN, Israel DA, Peek Jr RM, Kamioka M, Yanai H, Morimoto N, Sugiura T. Effect of
Helicobacter pylori cdrA on interleukin-8 secretions and nuclear factor kappa B activation. World J Gastroenterol 2012; 18(5): 425-434 - URL: https://www.wjgnet.com/1007-9327/full/v18/i5/425.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i5.425