Effect of Helicobacter pylori cdrA on interleukin-8 secretions and nuclear factor kappa B activation

Table 1 The sequence of primers used and the target region of cell division-related gene A amplified with combination of primers

Primers	Sequence (5’-3’)	Reference	Combination of primers	Target region of cell division-related gene A
P1 (forward)	TGAAGCACACGAAAGGA	17	P1-P3	N-terminal to central
P3 (reverse)	CATGCTCTAAAATCGTCG	17	P1-P3J	N-terminal to central
P3J (reverse)	ATCACCACGATCAGTCTG	This study	P3-P4	Central
P4 (forward)	TTTTGAGATCGGTGAAGC	17	P3J-P4J	Central
P4J (forward)	AACCACACGCTCATTTGC	This study	P4-P9J	Central to C-terminal
P9J (reverse)	GCTGAAAGGCCTGAATTCAG	This study	P4J-P9J	Central to C-terminal

Table 2 Helicobacter pylori cell division-related gene A status (positive or negative) and genotype (allele type) in clinical isolates n (%)

H. pylori cdrA
Status	Genotype	United States (48 patients)1	Japan (51 patients)
Positive	TypeI	0 (0)	4 (7.8)
	Type II	13 (16.9)	46 (90.2)
Negative	Type III	29 (37.7)	1 (2.0)
	Type IV	35 (45.4)	0 (0)
Total		772	51

H. pylori cdrA: Helicobacter pylori cell division-related gene A.

¹In 29 out of 48 patients, each isolate was obtained from both antrum and corpus in same stomach;

²The total 77 isolates include 44 and 33 isolates obtained from antrum and corpus, respectively.

Table 3 Comparison of cell division-related gene A status and genotype (allete type) between antrum and corpus isolates in 29 American patients

cdrA status1			cdrA genetype (allele type)
cdrA positive (6 cases)	Same2: 1	Antrum (+)3			Antrum	Corpus
		Corpus (+)	Identical4: 1		Type II	Type II
	Difference: 5	Antrum (+)	Difference: 5	4	Type II	Type III
		Corpus (-)		1	Type II	Type IV
cdrA negative (23 cases)	Same: 22	Antrum (-)	Identical: 16	5	Type III	Type III
		Corpus (-)		11	Type IV	Type IV
	Difference: 1	Antrum (-)	Difference: 7	4	Type III	Type IV
		Corpus (+)		2	Type IV	Type III
				1	Type IV	Type II
Total (%)	Same: 23 (79)		Same: 17 (59)
	Difference: 6 (21)		Difference: 12 (41)

¹The status of cell division-related gene A (cdrA) determined with isolate from antrum was divided to two category groups (cdrA positive and negative);

²Same or difference: cdrA status is same or difference between isolate (antrum and corpus);

³+: cdrA positive isolate; -: cdrA negative isolate;

⁴Identical or difference: the genotypes of cdrA is identical or difference between isolate (antrum and corpus). Bold denotes the 6 cases representing differences at cdrA status and genotype between isolates (antrum and corpus).