©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 28, 2012; 18(48): 7348-7356
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7348
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7348
Table 1 Primers for reverse transcription polymerase chain reaction
| Gene | Primer sequence | Size (bp) | Annealing temperature |
| β-actin | F: TCAGGTCATCACTATCGGCAAT | 432 | 57 °C |
| R: AAAGAAAGGGTGTAAAAGGCA | |||
| JNK | F: CACAGTCCTAAAACGATACC | 354 | 57 °C |
| R: CCACACAGCATTTGATAGAG |
Table 2 Cell cycle of SGC-7901 cells following thermotherapy for various time periods (%)
Table 3 Apoptotic rate of SGC-7901 cells with or without SP600125 treatment following thermotherapy for various time periods as determined by flow cytometry and terminal deoxynucleotidyl transferase dUTP nick end labeling assay
| Apoptotic rate(%) | ||
| Group (h) | Control group | SP600125 group |
| Flow cytometry | ||
| 0 | 7.3 ± 0.10 | 3.2 ± 0.08 |
| 0.5 | 46.5 ± 0.23b | 21.8 ± 0.15bd |
| 1 | 39.9 ± 0.53b | 17.9 ± 0.26bd |
| 2 | 56.6 ± 0.35b | 22.4 ± 0.36bd |
| 3 | 50.4 ± 0.29b | 24.5 ± 0.72bd |
| TUNEL assay | ||
| 0 | 12.2 ± 0.22 | 11.3 ± 0.13 |
| 0.5 | 48.2 ± 0.40b | 25.8 ± 0.19ad |
| 1 | 40.1 ± 0.20b | 19.2 ± 0.09ad |
| 2 | 61.2 ± 0.29b | 26.3 ± 0.23ad |
| 3 | 52.0 ± 0.42b | 23.4 ± 0.36ad |
- Citation: Xiao F, Liu B, Zhu QX. c-Jun N-terminal kinase is required for thermotherapy-induced apoptosis in human gastric cancer cells. World J Gastroenterol 2012; 18(48): 7348-7356
- URL: https://www.wjgnet.com/1007-9327/full/v18/i48/7348.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i48.7348
