©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 28, 2012; 18(48): 7251-7261
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7251
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7251
Table 1 Primer sequences and fragment sizes of polymerase chain reaction products
| Gene | SNPs site (refSNP ) | Primer sequence(5’-3’) | Fragment sizes of PCR products (bp) |
| CDH17 | c.343A>G (rs2243518) | Forward primer: CCAACATGGTTTCCTTTTCCTC | 159 |
| Reverse primer: GTTCTGCCTTACTGAGCCTTCG | |||
| c.2216A>C (rs1051624) | Forward primer: AATCCAGGGTCTGAAGTTGTA | 198 | |
| Reverse primer: TACTAGCCTGAGTTGCCTATA |
Table 2 The correlation between the genotype of CDH17 gene c.343A>G and clinicopathologic parameters in colorectal carcinomas n (%)
| Clinicopathologic parameters | n | Genotype CDH17 c.343A>G | χ2 | P value | ||
| A/A | A/G | G/G | ||||
| Gender | ||||||
| Male | 47 | 10 (21.3) | 25 (53.2) | 12 (25.5) | 2.236 | 0.327 |
| Female | 46 | 16 (34.8) | 19 (41.3) | 11 (23.9) | ||
| Age (yr) | ||||||
| < 50 | 29 | 10 (34.5) | 15 (51.7) | 4 (13.8) | 2.854 | 0.240 |
| ≥ 50 | 64 | 16 (25) | 29 (45.3) | 19 (29.7) | ||
| Tumor location | ||||||
| Colon | 32 | 8 (25.0) | 16 (50.0) | 8 (25.0) | 0.229 | 0.892 |
| Rectum | 61 | 18 (29.5) | 28 (45.9) | 15 (24.6) | ||
| Tumor size (cm) | ||||||
| < 5 | 68 | 18 (26.5) | 34 (50.0) | 16 (23.5) | 0.734 | 0.693 |
| ≥ 5 | 25 | 8 (32.0) | 10 (40.0) | 7 (28.0) | ||
| Macroscopic appearance | ||||||
| Protrude type | 31 | 8 (25.8) | 17 (54.8) | 6 (19.4) | 1.948 | 0.7451 |
| Ulcer type | 46 | 12 (26.1) | 21 (45.7) | 13 (28.3) | ||
| Infiltrating type | 16 | 6 (37.5) | 6 (37.5) | 4 (25.0) | ||
| Colloid type | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Histologic type | ||||||
| Adenocarcinoma | 71 | 18 (25.4) | 34 (47.9) | 19 (26.8) | 2.179 | 0.7031 |
| Adenocarcinoma and mucinous carcinoma | 9 | 4 (44.4) | 3 (33.3) | 2 (22.2) | ||
| Mucinous carcinoma | 13 | 4 (30.8) | 7 (53.8) | 2 (15.4) | ||
| Undifferentiated carcinoma | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Adenosquamous carcinoma | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Squamous cell carcinoma | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Invasion depth | ||||||
| Submucosa | 2 | 0 (0.0) | 2 (100.0) | 0 (0.0) | 0.696 | 0.7062 |
| Muscular layer | 34 | 12 (35.3) | 15 (44.1) | 7 (20.6) | ||
| Serous coat | 48 | 12 (25) | 21 (43.8) | 15 (31.3) | ||
| Other organs | 9 | 2 (22.2) | 6 (66.7) | 1 (11.1) | ||
| Differentiation degree | ||||||
| Well-differentiated | 4 | 0 (0.0) | 2 (50.0) | 2 (50.0) | 2.212 | 0.3312 |
| Moderately-differentiated | 63 | 17 (27.0) | 33 (52.4) | 13 (20.6) | ||
| Poorly-differentiated | 26 | 9 (34.6) | 9 (34.6) | 8 (30.8) | ||
| Lymph node metastasis | ||||||
| No | 59 | 16 (27.1) | 35 (59.3) | 8 (13.6) | 13.105 | 0.0013 |
| Yes | 34 | 10 (29.4) | 9 (26.5) | 15 (44.1) | ||
| TNM grade | ||||||
| I | 26 | 8 (30.8) | 16 (61.5) | 2 (7.7) | 10.344 | 0.00623 |
| II | 31 | 7 (22.6) | 18 (58.1) | 6 (19.4) | ||
| III | 33 | 9 (27.3) | 9 (27.3) | 15 (45.5) | ||
| IV | 3 | 2 (66.7) | 1 (33.3) | 0 (0.0) | ||
| Hematogenous metastasis | ||||||
| No | 90 | 24 (26.7) | 43 (47.8) | 23 (25.6) | 2.556 | 0.2791 |
| Yes | 3 | 2 (66.7) | 1 (33.3) | 0 (0.0) | ||
| Recurrence | ||||||
| No | 91 | 24 (26.4) | 44 (48.4) | 23 (25.3) | 5.267 | 0.0721 |
| Yes | 2 | 2 (100.0) | 0 (0.0) | 0 (0.0) | ||
Table 3 The correlation between the genotype of CDH17 gene c.2216A>C and clinicopathologic parameters in colorectal carcinomas n (%)
| Clinicopathologic parameters | n | Genotype CDH17 c.2216A>G | χ2 | P value | ||
| A/A | A/C | C/C | ||||
| Gender | ||||||
| Male | 47 | 20 (42.6) | 5 (10.6) | 22 (46.8) | 3.656 | 0.161 |
| Female | 46 | 11 (23.9) | 7 (15.2) | 28 (60.9) | ||
| Age (yr) | ||||||
| < 50 | 29 | 6 (20.7) | 5 (17.2) | 18 (62.1) | 3.176 | 0.204 |
| ≥ 50 | 64 | 25 (39.1) | 7 (10.9) | 32 (50.0) | ||
| Tumor location | ||||||
| Colon | 32 | 10 (31.3) | 6 (18.8) | 16 (50.0) | 1.485 | 0.476 |
| Rectum | 61 | 21 (34.4) | 6 (9.8) | 34 (55.7) | ||
| Tumor size (cm) | ||||||
| < 5 | 68 | 25 (36.8) | 5 (7.4) | 38 (55.9) | 7.144 | 0.0283 |
| ≥ 5 | 25 | 6 (24.0) | 7 (28.0) | 12 (48.0) | ||
| Macroscopic appearance | ||||||
| Protrude type | 31 | 11 (35.5) | 4 (12.9) | 16 (51.6) | 1.025 | 0.9061 |
| Ulcer type | 46 | 16 (34.8) | 5 (10.9) | 25 (54.3) | ||
| Infiltrating type | 16 | 4 (25.0) | 3 (18.8) | 9 (56.3) | ||
| Colloid type | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Histologic type | ||||||
| Adenocarcinoma | 71 | 23 (32.4) | 10 (14.1) | 38 (53.5) | 1.684 | 0.7941 |
| Adenocarcinoma and mucinous carcinoma | 9 | 4 (44.4) | 0 (0.0) | 5 (55.6) | ||
| Mucinous carcinoma | 13 | 4 (30.8) | 2 (15.4) | 7 (53.8) | ||
| Undifferentiated carcinoma | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Adenosquamous carcinoma | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Squamous cell carcinoma | 0 | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| Invasion depth | ||||||
| Submucosa | 2 | 2 (100.0) | 0 (0.0) | 0 (0.0) | 1.610 | 0.4472 |
| Muscular layer | 34 | 12 (35.3) | 4 (11.8) | 18 (52.9) | ||
| Serous coat | 48 | 14 (29.2) | 5 (10.4) | 29 (60.4) | ||
| Other organs | 9 | 3 (33.3) | 3 (33.3) | 3 (33.3) | ||
| Differentiation degree | ||||||
| Well-differentiated | 4 | 0 (0.0) | 0 (0.0) | 4 (100.0) | 0.090 | 0.9562 |
| Moderately-differentiated | 63 | 24 (38.1) | 9 (14.3) | 30 (47.6) | ||
| Poorly-differentiated | 26 | 7 (26.9) | 3 (11.5) | 16 (61.5) | ||
| Lymph node metastasis | ||||||
| No | 59 | 25 (42.4) | 10 (16.9) | 24 (40.7) | 11.143 | 0.0043 |
| Yes | 34 | 6 (17.6) | 2 (5.9) | 26 (76.5) | ||
| TNM grade | ||||||
| I | 26 | 12 (46.2) | 4 (15.4) | 10 (38.5) | 6.710 | 0.03523 |
| II | 31 | 12 (38.7) | 5 (16.1) | 14 (45.2) | ||
| III | 33 | 6 (18.2) | 2 (6.1) | 25 (75.8) | ||
| IV | 3 | 1 (33.3) | 1 (33.3) | 1 (33.3) | ||
| Hematogenous metastasis | ||||||
| No | 90 | 30 (33.3) | 11 (12.2) | 49 (54.4) | 1.243 | 0.5371 |
| Yes | 3 | 1 (33.3) | 1 (33.3) | 1 (33.3) | ||
| Recurrence | ||||||
| No | 91 | 29 (31.9) | 12 (13.2) | 50 (54.9) | 4.088 | 0.1301 |
| Yes | 2 | 2 (100.0) | 0 (0.0) | 0 (0.0) | ||
Table 4 The correlation between the genotype and allele frequencies of CDH17 gene c.343A>G and lymph node metastasis n (%)
| Lymph node metastasis | OR (95%CI) | ||
| No | Yes | ||
| Genotype | |||
| A/G | 35 (59.3) | 9 (26.5) | 1.000 (reference) |
| A/A | 16 (27.1) | 10 (29.4) | 2.431 (0.828-7.139) |
| G/G | 8 (13.6) | 15 (44.1) | 7.292 (2.360-22.532) |
| Allele frequency | |||
| A | 67 (56.8) | 29 (42.6) | 1.000 (reference) |
| G | 51 (43.2) | 39 (57.4) | 1.767 (0.967-3.229) |
Table 5 The correlation between the genotype and allele frequency of CDH17 gene c.343A>G and tumor-node-metastasis grade n (%)
| TNM grade | Mean rank | ||||
| I | II | III | IV | ||
| Genotype | |||||
| A/G | 16 (61.5) | 18 (58.1) | 9 (27.3) | 1 (33.3) | 39.32 |
| A/A | 8 (30.8) | 7 (22.6) | 9 (27.3) | 2 (66.7) | 48.15 |
| G/G | 2 (7.7) | 6 (19.4) | 15 (45.5) | 0 (0.0) | 60.39 |
| Allele frequency | |||||
| A | 32 (61.5) | 32 (51.6) | 27 (40.9) | 5 (83.3) | 87.71 |
| G | 20 (38.5) | 30 (48.4) | 39 (59.1) | 1 (16.7) | 99.68 |
Table 6 The correlation between the genotype and allele frequency of CDH17 gene c.2216A>C and lymph node metastasis n (%)
| Lymph node metastasis | OR (95%CI) | ||
| No | Yes | ||
| Genotype | |||
| A/C | 10 (16.9) | 2 (5.9) | 1.000 (reference) |
| A/A | 25 (42.4) | 6 (17.6) | 1.200 (0.206-6.977) |
| C/C | 24 (40.7) | 26 (76.5) | 5.417 (1.076-27.272) |
| Allele frequency | |||
| A | 60 (50.8) | 14 (20.6) | 1.000 (reference) |
| C | 58 (49.2) | 54 (79.4) | 3.990 (2.002-7.953) |
Table 7 The correlation between the genotype and allele frequency of CDH17 gene c.2216A>C and tumor-node-metastasis grade n (%)
| TNM grade | Mean rank | ||||
| I | II | III | IV | ||
| Genotype | |||||
| A/C | 4 (15.4) | 5 (16.1) | 2 (6.1) | 1 (33.3) | 42 |
| A/A | 12 (46.2) | 12 (38.7) | 6 (18.2) | 1 (33.3) | 38.77 |
| C/C | 10 (38.5) | 14 (45.2) | 25 (75.8) | 1 (33.3) | 53.3 |
| Allele frequency | |||||
| A | 28 (53.8) | 29 (46.8) | 14 (21.2) | 3 (50.0) | 78.09 |
| C | 24 (46.2) | 33 (53.2) | 52 (78.8) | 3 (50.0) | 103.68 |
-
Citation: Chen RY, Cao JJ, Chen J, Yang JP, Liu XB, Zhao GQ, Zhang YF. Single nucleotide polymorphisms in the
CDH17 gene of colorectal carcinoma. World J Gastroenterol 2012; 18(48): 7251-7261 - URL: https://www.wjgnet.com/1007-9327/full/v18/i48/7251.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i48.7251