©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 28, 2012; 18(48): 7212-7224
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7212
Published online Dec 28, 2012. doi: 10.3748/wjg.v18.i48.7212
Table 1 Primer pairs for quantitative real-time polymerase chain reaction
| Gene | Primer Sequence (5’ to 3’) | Size of PCR product (bp) | |
| Sense | Anti-sense | ||
| HDAC6 | ACCGCTACGAGCAGGGTA | CGAGACGTGCAGGAAAGC | 155 |
| TARF1 | TCCCGTAACACCTGATTAA | ACAACTCCCAAACCATACAC | 146 |
| GAPDH | AACGGATTTGGTCGTATTGGG | TCGCTCCTGGAAGATGGTGAT | 216 |
Table 2 Pathological outcomes of gastric mucosae from Mongolian gerbils lavaged with the most virulent gastric carcinoma-derived strain, the least virulent chronic gastritis-derived strain, and the control broth over 52 wk
Table 3 Differentially expressed genes with a fold change of > 2.0 or < 0.5 in GES-1 cells co-cultured with the most virulent gastric carcinoma-derived strain vs the least virulent chronic gastritis-derived strain
| Gene name (n = 185) | Fold change GC/CG | Accession number |
| Cell cycle related genes | ||
| AMN1 | 4.748 | BG031897 |
| HDAC6 | 2.025 | NM_006044 |
| CCNE2 | 0.464 | AF112857 |
| KIF20B | 0.462 | NM_016195 |
| DOCK8 | 0.456 | AL161725 |
| ASPM | 0.452 | AK001380 |
| CENPF | 0.450 | U30872 |
| NIPBL | 0.432 | NM_015384 |
| SYCP2 | 0.424 | NM_014258 |
| ASPM | 0.414 | NM_018123 |
| SGOL2 | 0.401 | N31731 |
| CENPE | 0.398 | NM_001813 |
| CEP70 | 0.382 | NM_024491 |
| SGOL2 | 0.375 | AW965339 |
| DOCK11 | 0.363 | AI742838 |
| SERPINB3 | 0.290 | BC005224 |
| Apoptosis-related genes | ||
| TRAF1 | 2.254 | NM_005658 |
| TIA1 | 0.496 | AL567227 |
| OPA1 | 0.474 | AB011139 |
| PIK3CA | 0.450 | NM_006218 |
| NUDT12 | 0.408 | AL136592 |
| PEG10 | 0.367 | BE858180 |
| Cytoskeleton and sports | ||
| ADD3 | 0.450 | AI818488 |
| KIAA0774 | 0.429 | AI818409 |
| KIF14 | 0.379 | AW183154 |
| KIF14 | 0.370 | NM_014875 |
| ADD3 | 0.344 | BE545756 |
| ADD3 | 0.316 | NM_019903 |
| Intracellular transport | ||
| VPS13A | 0.435 | AW629014 |
| VPS13A | 0.438 | AW629014 |
| IFT74 | 0.431 | NM_025103 |
| GOLGA4 | 0.425 | NM_002078 |
| ANKRD10 | 0.419 | BE670056 |
| IFT80 | 0.414 | AB037795 |
| FAM8A1 | 0.412 | NM_016255 |
| SNX2 | 0.406 | NM_003100 |
| ANKRD32 | 0.355 | AL136560 |
| DNA synthesis, repair, recombination | ||
| RAD50 | 0.472 | NM_005732 |
| SFPQ | 0.457 | AV705803 |
| FAM8A1 | 0.412 | NM_016255 |
| LIN9 | 0.338 | BF697734 |
| DNA-binding ,transcription, transcription factor | ||
| ZNF253 | 5.254 | NM_021047 |
| KLF11 | 3.598 | AA149594 |
| SMARCA1 | 0.496 | NM_003069 |
| GOLGB1 | 0.492 | NM_004487 |
| KLF9 | 0.462 | NM_001206 |
| CHD1 | 0.459 | NM_001270 |
| PBX1 | 0.455 | AL049381 |
| TRIP11 | 0.434 | AF007217 |
| SMARCA1 | 0.433 | NM_003069 |
| C8orf83 | 0.433 | BE962119 |
| EPM2AIP1 | 0.430 | BF432224 |
| ELL2 | 0.420 | AI745624 |
| GLCCI1 | 0.400 | AA058770 |
| ARID5B | 0.395 | BG285011 |
| ZNF644 | 0.390 | NM_016620 |
| BAZ2B | 0.365 | NM_013450 |
| SAMD9 | 0.352 | AA741307 |
| SAMD9 | 0.345 | NM_017654 |
| TPR | 0.346 | BF110993 |
| TPR | 0.344 | AK023111 |
| LCORL | 0.339 | AI807408 |
| TPR | 0.300 | AW235355 |
| Cell signal and transduction | ||
| PRKCB | 0.498 | M13975 |
| DST | 0.493 | NM_001723 |
| FARP1 | 0.462 | BF725250 |
| GMFB | 0.461 | NM_004124 |
| PPM1A | 0.454 | AA886888 |
| IFT81 | 0.444 | NM_014055 |
| PDE10A | 0.442 | AI143879 |
| ICK | 0.428 | NM_014920 |
| ANKRD10 | 0.419 | BE670056 |
| IFT80 | 0.414 | AB037795 |
| SNX2 | 0.406 | NM_003100 |
| CNTLN | 0.386 | AA280904 |
| MAP2K6 | 0.384 | NM_002758 |
| ANKRD32 | 0.355 | AL136560 |
| ARHGAP18 | 0.307 | BE644830 |
| Protein translation, synthesis, decomposition | ||
| RHOBTB3 | 0.500 | NM_014899 |
| ST13 | 0.490 | U17714 |
| EEF2K | 0.488 | W68180 |
| TSHZ2 | 0.476 | AW953679 |
| TMF1 | 0.417 | AI767750 |
| HMMR | 0.410 | U29343 |
| CCDC88A | 0.387 | AB033038 |
| NSBP1 | 0.321 | BC005342 |
| Protein-coding gene | ||
| CXorf39 | 0.499 | AI590719 |
| LOC286052 | 0.478 | AA278233 |
| FLJ40113/LOC440295 | 0.411 | AI632181 |
| LOC100133781 | 0.374 | AA973100 |
| LOC100130360 | 0.346 | BG231554 |
| LOC643401 | 0.300 | BC039509 |
| Ion channel and transport | ||
| IFT74 | 0.496 | AI610355 |
| SLC5A3 | 0.493 | AK024896 |
| SLC2A13 | 0.489 | AL565362 |
| STEAP4 | 0.488 | NM_024636 |
| TMEM56 | 0.469 | AI004375 |
| EXOC5 | 0.466 | BF509391 |
| CACNB2 | 0.465 | AI040163 |
| SLC2A13 | 0.455 | NM_052885 |
| TMEM133 | 0.435 | AF247167 |
| DMXL2 | 0.405 | AB020663 |
| SNX13 | 0.401 | R75838 |
| SEC62 | 0.397 | NM_153039 |
| ATP11C | 0.382 | BF475862 |
| TMEM106B | 0.380 | BF513060 |
| PEG10 | 0.367 | BE858180 |
| SORBS2 | 0.222 | AI659533 |
| Cell proliferation, angiogenesis | ||
| ANGPTL4 | 2.460 | NM_016109 |
| TPR | 0.492 | NM_003292 |
| TPR | 0.492 | NM_003292 |
| PNN | 0.487 | U59479 |
| PNN | 0.428 | U59479 |
| ROCK2 | 0.404 | AL049383 |
| TTK | 0.347 | NM_003318 |
| Immune-related genes | ||
| CFI | 0.477 | NM_000204 |
| SERPINB4 | 0.431 | AB046400 |
| PIBF1 | 0.423 | NM_006346 |
| Metabolize-related genes | ||
| AK7 | 0.477 | NM_152327 |
| TTC3 | 0.471 | AI652848 |
| HS2ST1 | 0.438 | NM_012262 |
| MANEA | 0.427 | AI587307 |
| PLA2G12A | 0.416 | AV714268 |
| TTC3 | 0.413 | D83077 |
| PPP1CB | 0.407 | W67887 |
| NUDT12 | 0.408 | AL136592 |
| TTC3 | 0.403 | NM_003316 |
| TTC3 | 0.403 | AI885338 |
| RNF150 | 0.398 | AA722069 |
| SEPP1 | 0.396 | NM_005410 |
| CRYZ | 0.387 | NM_001889 |
| PDK4 | 0.374 | AV707102 |
| ABAT | 0.359 | AF237813 |
| PLA2G12A | 0.331 | AI767751 |
| AGXT2L1 | 0.326 | NM_031279 |
| CYP1B1t | 0.314 | NM_000104 |
| METTL7A | 0.274 | NM_014033 |
| Cell structure-related genes | ||
| ARMCX3 | 0.385 | AL121883 |
| ANK3 | 0.225 | NM_020987 |
| Cell Adhesion-related genes | ||
| KITLG | 0.447 | AI446414 |
| PIK3CA | 0.450 | NM_006218 |
| ANKRD10 | 0.419 | BE670056 |
| ANKRD32 | 0.355 | AL136560 |
| Stress-related genes | ||
| DNAJB4 | 0.400 | BG252490 |
| LXN | 0.294 | NM_020169 |
| DNAJB4 | 0.471 | NM_007034 |
| Protein regulation | ||
| LOC727770 | 0.426 | AI359676 |
| TBC1D8B | 0.368 | AW172431 |
| Cell differentiation | ||
| LIFR | 0.374 | AA701657 |
| RNA processing | ||
| SR140 | 0.413 | AU152088 |
| Protein receptor | ||
| LANCL1 | 0.412 | NM_006055 |
| Oxidation | ||
| DIO2 | 0.434 | AI038059 |
| Cell growth-related genes | ||
| ITCH | 0.441 | AA868238 |
| TGFBR3 | 0.450 | AW193698 |
| TGFBR3 | 0.422 | NM_003243 |
| Cytokine receptor | ||
| LTB | 2.001 | NM_002341 |
Table 4 Most differentially expressed genes in GES-1 cells co-cultured with the most virulent gastric carcinoma-derived strain vs the least virulent chronic gastritis-derived strain
| Gene name | Betweenness centrality | Description | Identified or proposed function |
| JUN | 0.201780 | Jun oncogene | Cell growth and/or maintenance, signal transduction molecules, and transcription factors |
| KRAS | 0.185944 | v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog | Regulation of cell cycle, cell growth and/or maintenance |
| BRCA1 | 0.162070 | Breast cancer 1, early onset | DNA damage checkpoint; p53/ATM signaling, and induction of apoptosis |
| SMAD2 | 0.121460 | SMAD family member 2 | Transcription factors |
| TRAF1 | 0.092496 | Tumor necrosis factor receptor-associated factor 1 | DNA damage checkpoint, p53/NF-KB signaling, and cell cycle control |
| HDAC6 | 0.092239 | Histone deacetylase 6 | Cell proliferation and tumor angiogenesis |
-
Citation: Wang F, Luo LD, Pan JH, Huang LH, Lv HW, Guo Q, Xu CX, Shen SR. Comparative genomic study of gastric epithelial cells co-cultured with
Helicobacter pylori . World J Gastroenterol 2012; 18(48): 7212-7224 - URL: https://www.wjgnet.com/1007-9327/full/v18/i48/7212.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i48.7212