Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 21, 2012; 18(47): 7093-7099
Published online Dec 21, 2012. doi: 10.3748/wjg.v18.i47.7093
Published online Dec 21, 2012. doi: 10.3748/wjg.v18.i47.7093
Table 1 Primer sequences, polymerase chain reaction and denaturing high-performance liquid chromatography conditions for detection of gene polymorphisms
| Gene | Primer sequence | PCR annealing temperature (°C) | PCR product size (bp) | DHPLC application type | Oven temperature (°C) |
| IL-1B-31 | F: AGAAGCTTCCACCAATACTC | 60 | 240 | Mutation | 59 |
| R: AGCACCTAGTTGTAAGGAAG | |||||
| IL-1B-511 | F: TGGCATTGATCTGGTTCATC | 58.5 | 306 | Mutation | 60.5 |
| R: GTTTAGGAATCTTCCCACTT | |||||
| IL-1 RN | F: CCCCTCGAGCAACATCC | 59 | 270-442 | VNTR | 50.0 |
| R: GGTCAGAAGGGCAGAGA |
Table 2 Selective characteristics and risk factors in patients with gastric cancer and controls from the Tibet, Hui and Han ethnicities n (%)
| Variable | Tibet | Hui | Han | ||||||||||
| Cases(n = 155) | Controls(n = 210) | χ2 | P value | Cases(n = 158) | Controls(n = 205) | χ2 | P value | Cases(n = 197) | Controls(n = 202) | χ2 | P value | ||
| Age, yr | < 35 | 3 (1.94) | 5 (2.38) | 0.006 | 0.940 | 2 (1.27) | 2 (0.980) | 0.069 | 0.793 | 5 (2.54) | 5 (2.48) | 0.602 | 0.437 |
| 35-60 | 82 (52.90) | 110 (52.38) | 0.010 | 0.921 | 75 (47.46) | 102 (49.76) | 0.187 | 0.665 | 98 (49.75) | 106 (52.48) | 0.297 | 0.586 | |
| ≥ 60 | 70 (45.16) | 95 (45.24) | 0.000 | 0.988 | 81 (51.27) | 101 (49.24) | 0.142 | 0.706 | 94 (47.71) | 91 (45.04) | 0.285 | 0.593 | |
| Gender | Male | 116 (74.84) | 154 (73.33) | 0.105 | 0.746 | 116 (73.42) | 148 (71.20) | 0.067 | 0.795 | 146 (74.62) | 151 (74.75) | 0.003 | 0.952 |
| Female | 39 (25.16) | 56 (26.67) | 42 (26.58) | 57 (28.80) | 50 (25.38) | 51 (25.25) | |||||||
| Smoking | Yes | 99 (63.87) | 135 (64.29) | 0.007 | 0.935 | 28 (17.71) | 40 (19.51) | 0.188 | 0.665 | 131 (66.50) | 129 (63.86) | 0.200 | 0.655 |
| No | 56 (36.13) | 75 (35.71) | 130 (82.29) | 165 (80.49) | 66 (33.50) | 73 (36.14) | |||||||
| Hp | Positive | 101 (65.16) | 112 (53.33) | 5.134 | 0.023 | 100 (63.29) | 95 (46.34) | 10.311 | 0.001 | 124 (62.94) | 105 (51.98) | 4.903 | 0.027 |
| Negative | 54 (34.84) | 98 (46.67) | 58 (36.71) | 110 (53.66) | 73 (37.06) | 97 (48.02) | |||||||
Table 3 Genotype distributions of interleukin-1B-31, interleukin-1B-511 and interleukin-1RN gene polymorphisms among gastric cancer cases and controls from the Tibet, Hui and Han ethnicities n (%)
| Genotype | Tibet | Hui | Han | |||||||||
| Cases | Controls | OR (95%CI)1 | P value | Cases | Controls | OR (95%CI)1 | P value | Cases | Controls | OR (95%CI)1 | P value | |
| IL-1B-31 | ||||||||||||
| TT | 23 (14.84) | 47 (22.38) | 1 | 46 (29.11) | 59 (28.78) | 1 | 40 (20.30) | 65 (32.18) | 1 | |||
| CT | 81 (52.26) | 112 (53.33) | 1.47 (0.81-2.66) | 0.208 | 79 (50.00) | 105 (51.22 | 0.97 (0.58-1.62) | 0.896 | 102 (51.77) | 98 (48.52) | 1.69 (1.03-2.76) | 0.036 |
| CC | 51 (32.90) | 51 (24.29) | 2.10 (1.09-4.04) | 0.027 | 33 (20.89) | 41 (20.00) | 1.03 (0.55-1.95) | 0.919 | 55 (27.92) | 39 (19.31) | 2.29 (1.28-4.10) | 0.005 |
| IL-1B-511 | ||||||||||||
| CC | 34 (21.94) | 55 (26.19) | 1 | 33 (20.89) | 43 (20.98) | 1 | 31 (15.74) | 65 (32.17) | 1 | |||
| CT | 80 (51.61) | 93 (44.29) | 1.37 (0.80-2.35) | 0.210 | 88 (55.70) | 110 (53.66) | 1.04 (0.59-1.83) | 0.888 | 101 (51.27) | 99 (49.09) | 2.16 (1.28-3.65) | 0.004 |
| TT | 41 (26.45) | 62 (29.52) | 1.02 (0.56-1.86) | 0.945 | 37 (23.41) | 52 (25.37) | 0.96 (0.50-1.84) | 0.891 | 65 (32.99) | 38 (18.81) | 3.53 (1.49-8.33) | 0.004 |
| IL-1RN | ||||||||||||
| L/L | 129 (83.22) | 185 (88.10) | 1 | 94 (59.49) | 156 (76.10) | 1 | 166 (84.26) | 171 (84.66) | 1 | |||
| 2/L | 26 (16.78) | 25 (11.90) | 1.50 (0.80-2.79) | 0.206 | 64 (40.50) | 49 (23.90) | 2.11 (1.31-3.40) | 0.002 | 31 (15.28) | 31 (14.44) | 1.03 (0.59-1.79) | 0.924 |
Table 4 Genotype distributions of the interleukin-1B-31, interleukin-1B-511 and interleukin-1RN polymorphisms among different subtypes of gastric cancer in patients from the Tibet, Hui and Han ethnicities n (%)
| Tibet | Hui | Han | |||||||||||||||||||
| Genetype | Intestinal cases | Diffuse cases | Intestinal cases | Diffuse cases | Intestinal cases | Diffuse cases | |||||||||||||||
| Controls | Cases | OR (95%CI)1 | P value | Cases | OR (95%CI)1 | P value | Controls | Cases | OR (95%CI)1 | P value | Cases | OR (95%CI)1 | P value | Controls | Cases | OR (95%CI)1 | P value | Cases | OR (95%CI)1 | P value | |
| IL-1B-31 | |||||||||||||||||||||
| TT | 47 (22.38) | 16 (14.68) | 1 | 7 (15.22) | 1 | 59 (28.78) | 33 (32.29) | 1 | 13 (25.00) | 1 | 65 (32.18) | 28 (20.14) | 1 | 12 (20.69) | 1 | ||||||
| CT | 112 (53.33) | 56 (51.38) | 1.46 (0.75-2.84) | 0.271 | 25 (54.35) | 1.48 (0.59-3.70) | 0.407 | 105 (51.22) | 51 (48.11) | 0.87 (0.49-1.54) | 0.618 | 28 (53.85) | 1.11 (0.51-2.39) | 0.792 | 98 (48.52) | 70 (50.36) | 1.68 (0.97-2.90) | 0.067 | 32 (55.17) | 2.00 (0.82-4.88) | 0.126 |
| CC | 51 (24.29) | 37 (33.94) | 2.17 (1.05-4.51) | 0.037 | 14 (30.43) | 1.86 (0.68-5.09) | 0.228 | 41 (20.00) | 22 (21.28) | 0.93 (0.46-1.90) | 0.845 | 11 (21.15) | 1.18 (0.46-3.01) | 0.734 | 39 (19.31) | 41 (29.50) | 2.51 (1.32-4.76) | 0.005 | 14 (24.14) | 1.79 (0.85-3.77) | 0.126 |
| IL-1B-511 | |||||||||||||||||||||
| CC | 55 (26.19) | 22 (20.18) | 1 | 12 (25.53) | 1 | 43 (20.98) | 23 (21.70) | 1 | 10 (19.23) | 1 | 65 (32.17) | 16 (11.51) | 1 | 15 (25.86) | 1 | ||||||
| CT | 93 (44.29) | 54 (49.54) | 1.48 (0.76-2.60) | 0.277 | 26 (55.32) | 1.28 (0.59-2.79) | 0.535 | 110 (53.66) | 58 (54.72) | 1.00 (0.53-1.89) | 0.998 | 30 (57.69) | 1.13 (0.48-2.62) | 0.784 | 99 (49.09) | 69 (49.64) | 2.74 (1.44-5.22) | 0.002 | 32 (55.17) | 1.45 (0.72-2.93) | 0.301 |
| TT | 62 (29.52) | 33 (30.28) | 1.25 (0.64-2.42) | 0.518 | 9 (19.15) | 0.62 (0.24-1.63) | 0.336 | 52 (25.37) | 25 (23.58) | 0.91 (0.43-1.92) | 0.811 | 12 (23.08) | 0.92 (0.34-2.50) | 0.872 | 38 (18.81) | 54 (38.85) | 5.66 (2.82-11.33) | 0 | 11 (18.97) | 1.23 (0.50-3.02) | 0.645 |
| IL-1RN | |||||||||||||||||||||
| L/L | 185 (88.10) | 93 (83.22) | 1 | 36 (84.78) | 1 | 156 (76.10) | 64 (60.38) | 1 | 30 (57.69) | 1 | 171 (84.66) | 116 (83.45) | 1 | 50 (86.21) | 1 | ||||||
| 2/L | 25 (11.90) | 16 (14.68) | 1.32 (0.66-2.66) | 0.439 | 10 (16.78) | 1.87 (0.79-4.43) | 0.158 | 49 (23.90) | 42 (39.62) | 2.08 (1.22-3.56) | 0.007 | 22 (42.31) | 2.31 (1.17-4.56) | 0.016 | 31 (14.44) | 23 (16.55) | 1.09 (0.59-1.97) | 0.807 | 8 (13.79) | 1.02 (0.43-2.39) | 0.971 |
- Citation: Zhao JD, Geng PL, Li ZQ, Cui S, Zhao JH, Wang LJ, Li JZ, Ji FX, Li GY, Shen GS, Lin MZ, Shen CF, Cao CZ. Associations between interleukin-1 polymorphisms and gastric cancers among three ethnicities. World J Gastroenterol 2012; 18(47): 7093-7099
- URL: https://www.wjgnet.com/1007-9327/full/v18/i47/7093.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i47.7093
