Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Oct 21, 2012; 18(39): 5542-5550
Published online Oct 21, 2012. doi: 10.3748/wjg.v18.i39.5542
Published online Oct 21, 2012. doi: 10.3748/wjg.v18.i39.5542
Table 1 Genes analyzed by real-time polymerase chain reaction in liver
| Gene symbol | Synonym | Accession number | Primer (forward/reverse) |
| Vegfa | Vascular endothelial growth factor A | NM031836 | CAGTTCGAGGAAAGGGAAAGGCAAATGCTTTCTCCGCTCTG |
| Hmox1 | Heme oxygenase (decycling) 1 | NM012580 | AGAGGCTAAGACCGCCTTCC AGGCCTCTGGCGAAGAAAC |
| Cdkn1a | Cyclin-dependent kinase inhibitor 1A | U24174 | CTTGCACTCTGGTGTCTCACG ATCGGCGCTTGGAGTGATAG |
| Timp1 | TIMP metallopeptidase inhibitor 1 | BC099821 | CCTGGTTCCCTGGCATAATC TTGCAAGGGATGGCTGAAC |
| Srebf1 | Sterol regulatory element binding protein-1 | AF286470 | AGAAGGCCAGTGGGTACCTG TGCGGGCCACAAGAAGTAG |
Table 2 Male and female Long-Evans cinnamon rats after copper diet
| Early hCu | Late hCu | rCu | Long-Evans agouti | |||||
| Male | Female | Male | Female | Male | Female | Female | ||
| Bilirubin | > 0.4 mg/dL1 (d) | 55 (67 ± 5) | 63 (60 ± 1) | 28 (30 ± 1) | 28 (32 ± 1) | 0.32 (0.3 ± 0) | 0.22 (0.2 ± 0) | 0.22 (0.2 ± 0) |
| AST | > 240 U/L1 (d) | 74 (75 ± 3) | 68 (68 ± 1) | 28 (34 ± 3) | 30 (33 ± 1) | 1152 (117 ± 4) | 1032 (103 ± 3) | 1142 (114 ± 5) |
| ALT | > 110 U/L1 (d) | 44 (50 ± 2) | 54 (54 ± 1) | 28 (30 ± 2) | 28 (31 ± 1) | 692 (69 ± 6) | 752 (75 ± 6) | 542 (54 ± 1) |
| Liver Cu | (μg/g) | 868 (880 ± 93) | 1036 (1058 ± 59) | 1494 (1452 ± 161) | 1235 (1178 ± 59) | 503 (495 ± 75) | 309 (326 ± 29) | 46 (44 ± 9) |
| Survival | (day after hCu) | 85 (81 ± 4) | 81 (75 ± 9) | 37 (37 ± 6) | 35 (35 ± 2) | NA | NA | NA |
- Citation: Siaj R, Sauer V, Stöppeler S, Spiegel HU, Köhler G, Zibert A, Schmidt HH. Dietary copper triggers onset of fulminant hepatitis in the Long-Evans cinnamon rat model. World J Gastroenterol 2012; 18(39): 5542-5550
- URL: https://www.wjgnet.com/1007-9327/full/v18/i39/5542.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i39.5542
