Prognostic relevance of circulating CK19 mRNA in advanced malignant biliary tract diseases

Table 1 Primer sequences

Primer	Forward	Reverse
hTERT	GCGGAAGACAGTGGTGAACT	AGC TGGAGTAGT CGCTCT GC
CK19	CCCGCGACTACAGCCACTA	GCTCATGCGCAGAGCCT
β-Actin	GTGGGGCGCCCCAGGCACCA	GTCCTTAATGTCACGCACGATTTC

hTERT: Human telomerase reverse transcriptase; CK19: Cytokeratin 19.

Table 2 Clinical characteristics of patients with advanced malignant biliary tract obstruction

	Parameters	n (%)
Gender	Male	23 (57.5)
	Female	17 (42.5)
Age (yr)	< 60	18 (45.0)
	> 60	22 (55.0)
Type of cancers	Hilar cholangiocarcinoma	28 (70.0)
	Pancreatic cancer	6 (15.0)
	Common bile duct cancer	2 (5.0)
	Ampullary cancer	2 (5.0)
	Gall bladder cancer	2 (5.0)

Table 3 Clinical characteristics of patients with negative and positive cytokeratin 19 and human telomerase reverse transcriptase gene expression

	CK19 gene		P value	hTERT gene		P value
	Negative	Positive		Negative	Positive
Age (yr)	63.80	61.38	0.42	65.26	60.88	0.16
Sex (male: female)	11:11	12:6	0.351	8:8	15:9	0.521
Total bilirubin (mg/dL)	16.21	16.42	0.95	17.73	15.47	0.53
Albumin (g/dL)	2.88	2.97	0.62	2.83	2.99	0.36
Globulin (g/dL)	3.98	3.76	0.42	3.92	3.84	0.79
AST (U/L)	84.57	112.80	0.23	69.27	117.48	0.12
ALT (U/L)	42.47	65.85	0.12	34.87	66.68	0.28
ALP (IU/L)	449.68	528.85	0.56	436.88	421.91	0.98
BUN (mg/dL)	13.77	26.58	0.13	12.25	23.52	0.18
Creatinine (mg/dL)	0.75	1.30	0.20	0.61	1.19	0.22
CA19-9 (U/mL)	570.20	594.30	0.622	1818.00	259.15	0.112
CEA (ng/mL)	7.47	5.68	0.502	7.21	5.82	0.232

Quantitative variables are presented as the mean value, with the exception of cancer antigen (CA)19-9 and carcinoembryonic antigen (CEA), which are presented as median values.

¹Pearson χ² was used to compare two groups;

²Mann-Whitney U test was used to compare groups. CK19: Cytokeratin 19; hTERT: Human telomerase reverse transcriptase; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase; ALP: Alkaline phosphatase; BUN: Blood urea nitrogen.

Table 4 Survival analysis using clinical parameters measured by univariable and multivariable analysis

Variables	Univariable analysis		Multivariate analysis
	P value	Hazard ratio	P value	Hazard ratio
		(95% CI)		(95% CI)
CK19 expression	0.0111	2.42 (1.22-4.78)	0.0241	3.20 (1.17-8.75)
hTERT expression	0.188	1.60 (0.80-3.22)	0.580	1.34 (0.47-3.82)
Age	0.541	0.82 (0.42-1.57)	0.0261	0.38 (0.16-0.89)
Total bilirubin	0.106	1.72 (0.89-3.31)	0.0021	3.97 (1.69-9.36)
Albumin	0.360	0.73 (0.37-1.35)	0.213	0.59 (0.26-1.35)
CA19-9	0.374	0.73 (0.37-1.43)	0.478	0.74 (0.32-1.70)
CEA	0.381	1.39 (0.68-2.88)	0.124	1.86 (0.84-4.12)

¹Statistically significant. CI: Confidence interval; CK19: Cytokeratin 19; hTERT: Human telomerase reverse transcriptase; CA: Cancer antigen; CEA: Carcinoembryonic antigen.