Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Mar 21, 2012; 18(11): 1235-1242
Published online Mar 21, 2012. doi: 10.3748/wjg.v18.i11.1235
Published online Mar 21, 2012. doi: 10.3748/wjg.v18.i11.1235
Table 1 Primer sequences, restriction enzymes and fragment sizes for toll-like receptor 2 and toll-like receptor 4 gene polymorphisms and interleukin-1β gene
Genes | Primers | Enzyme T°/time | Fragment (bp) | Ref. |
TLR2 | F: 5’-CACGGAGGCAGCGAGAAA-3’ | - | 286 | [24] |
del -196 to -174 | R: 5’-CTGGGCCGTGCAAAGAAG-3’ | ins/ins: 286 | ||
ins/del: 286, 264 | ||||
del/del: 264 | ||||
TLR4+896A/G | F: 5’-AGCATACTTAGACTACCACCTCGATG 3’ | BstXI | 131 | [34] |
rs4986790 | R: 5’-GTTGCCATCCGAAATTATAAGAAAAG 3’ | 37 °C, 1 h | A/A: 131 | |
A/G: 131, 108 | ||||
G/G: 108 | ||||
TLR4+1196C/T | F: 5’-GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA-3’ | HinfI | 407 | [33] |
rs4986791 | R: 5’-ACCTGAAGACTGGAGAGTGAGTTAAATGCT-3’ | 37 °C, 1 h | C/C: 407 | |
C/T: 407, 378 | ||||
T/T: 378 | ||||
IL1-β | F: CATGTGACCTGCTCGTCAGT | HinfI | 370 | [47] |
R: CCCTAGGGATTGAGTCCACA | 37 °C, 1 h | 195, 175 | ||
TLR2 | F: 5’-CACGGAGGCAGCGAGAAA-3’ | BstXI | 286 | [24] |
R: 5’-CTGGGCCGTGCAAAGAAG-3’ | 37 °C, 1 h | 188, 98 |
Table 2 Genotype and allele frequencies of toll-like receptor 2 (-196 to -174 del) and toll-like receptor 4 (rs4986790 and rs4986791) polymorphisms in gastric cancer, chronic gastritis and control groups
Genotypes/alleles | GC | C | CG |
n = 174 (%) | n = 225(%) | n = 208 (%) | |
TLR2 -196 to -174 | |||
ins/ins | 116 (66.6) | 189 (84.0) | 160 (76.9) |
del/ins | 50 (28.7) | 34 (15.1) | 41 (19.7) |
del/del | 8 (4.7) | 2 (0.9) | 7 (3.4) |
OR (95% CI) | 2.62 (1.63-4.22) 1.57 (0.97-2.54) | ||
P value | < 0.01 0.06 | ||
Alleles | |||
ins | 81.0 | 91.5 | 87.0 |
del | 19.0 | 8.5 | 13.0 |
OR (95% CI) | 2.53 (1.65-3.88) 1.65 (1.06-2.55) | ||
P value | < 0.01 0.02 | ||
TLR4 +896A/G | |||
(rs4986790) | |||
AA | 154 (88.5) | 215 (95.5) | 187 (89.9) |
AG | 20 (11.5) | 10 (4.5) | 21 (10.1) |
GG | 0 | 0 | 0 |
OR (95% CI) | 2.79 (1.27-6.13) 2.41 (1.10-5.25) | ||
P value | 0.01 0.02 | ||
Alleles | |||
A | 94.0 | 97.0 | 95.0 |
G | 6.0 | 3.0 | 5.0 |
OR (95% CI) | 2.68 (1.23-5.81) 2.33 (1.08-5.02) | ||
P value | 0.01 0.02 | ||
TLR4 +1196C/T | |||
(rs4986791) | |||
CC | 165 (94.8) | 219 (97.3) | 202 (97.1) |
CT | 9 (5.2) | 6 (2.7) | 6 (2.9) |
TT | 0 | 0 | 0 |
OR (95% CI) | 1.99 (0.69-5.70) 1.08 (0.34-3.41) | ||
P value | 0.28 1.00 | ||
Alleles | |||
C | 98.0 | 99.0 | 98.0 |
T | 2.0 | 1.0 | 2.0 |
OR (95% CI) | 1.96 (0.69-5.57) 1.08 (0.34-3.38) | ||
P value | 0.29 1.00 |
Table 3 Toll-like receptor 4 haplotype frequency distribution between gastric cancer, chronic gastritis and control groups
Haplotypes | GC (%) | C (%) | χ2 | P value | CG (%) | C (%) | χ2 | P value |
TLR4 +896/+1196 | ||||||||
A-C | 91.4 | 95.7 | 6.802 | < 0.01 | 94.0 | 95.7 | 1.361 | 0.24 |
G-C | 63.0 | 31.0 | 5.247 | 0.02 | 46.0 | 31.0 | 1.598 | 0.20 |
A-T | 21.0 | 11.0 | 1.461 | 0.22 | NF | NF | NF | NF |
Table 4 Combined effect of toll-like receptor 2 (-196 to -174 del) and toll-like receptor 4 (rs4986790 and rs4986791) polymorphisms on risk of gastric cancer and chronic gastritis
Risk genotype | Groups | ||||||||
GC (n = 174) | C (n = 225) | OR (95% CI)P value | CG (n = 208) | C (n = 225) | OR (95% CI)P value | GC (n =174) | CG (n = 225) | OR (95% CI)P value | |
Neither | 113 | 187 | 1.00 (reference) | 160 | 187 | 1.00 (reference) | 113 | 160 | 1.00 (reference) |
TLR2 ins/del or del/ del/TLR4+896 AG | 10 | 4 | 4.13 (1.26-13.50) | 11 | 4 | 3.21 (1.00-10.29) | 10 | 11 | 1.28 (0.52-3.13) |
0.02 | 0.06 | 0.64 | |||||||
TLR2 ins/del or del/ del/TLR4+1196 CT | 4 | 1 | 6.61 (0.73-59.99) | 1 | 1 | 1.16 (0.07-18.84) | 4 | 1 | 5.66 (0.62-51.37) |
0.07 | 1.00 | 0.16 | |||||||
TLR4+896 AG/ +1196 CT | 1 | 1 | 1.65 (0.10-26.73) | 3 | 1 | 3.50 (0.36-34.05) | 1 | 3 | 0.47 (0.04-4.59) |
1.00 | 0.34 | 0.64 |
Table 5 Distribution of risk factors, genotypes of toll-like receptor 2 (-196 to -174 del) and toll-like receptor 4 (rs4986790 and rs4986791), and odds ratios for gastric cancer, chronic gastritis and control groups
Variables | F (GC/C) % | OR (95% CI) | P value | F (CG/C) % | OR (95% CI) | P value |
Gender | ||||||
Female | 23/49.7 | Reference | < 0.01 | 51.0/50.3 | Reference | 0.96 |
Male | 77/50.3 | 2.70 (1.66-4.41) | 49.0/49.7 | 0.99 (0.66 -1.48) | ||
Age (yr) | ||||||
< 61 | 40.9/56.0 | Reference | 0.30 | 52.8/43.5 | (< 53 yr) Reference | 0.03 |
≥ 61 | 59.1/44.0 | 1.26 (0.81-1.98) | 47.2/56.5 | (≥ 53 yr) 0.64 (0.43-0.95) | ||
Smoking | ||||||
Nonsmokers | 30.5/34.3 | Reference | 0.13 | 44.8/34.3 | Reference | 0.01 |
Smokers | 69.5/65.7 | 0.67(0.39-1.13) | 55.2/65.7 | 0.57 (0.37-0.87) | ||
Alcohol | ||||||
Nondrinkers | 46.6/74.3 | Reference | < 0.01 | 68.2/74.3 | Reference | 0.06 |
Drinkers | 53.4/25.7 | 2.93 (1.76-4.87) | 31.8/25.7 | 1.54 (0.97-2.44) | ||
TLR2 | ||||||
ins/ins | 66.6/84.0 | Reference | < 0.01 | 76.9/84.0 | Reference | 0.18 |
ins/del | 33.4/16.0 | 2.64 (1.56-4.44) | 23.1/16.0 | 1.39 (0.84 -2.28) | ||
del/del | ||||||
TLR4 +896A/G (rs4986790) | ||||||
AA | 88.5/95.5 | Reference | < 0.01 | 89.9/95.5 | Reference | 0.04 |
AG | 11.5/4.5 | 3.19 (1.34-7.61) | 10.1/4.5 | 2.29 (1.02-5.13) | ||
TLR4 +1196C/T (rs4986791) | ||||||
CC | 94.8/97.3 | Reference | 0.63 | 97.1/97.3 | Reference | 0.91 |
CT | 5.2/2.7 | 1.33 (0.41-4.33) | 2.9/2.7 | 0.93 (0.28-3.05) |
-
Citation: de Oliveira JG, Silva AE. Polymorphisms of the
TLR2 andTLR4 genes are associated with risk of gastric cancer in a Brazilian population. World J Gastroenterol 2012; 18(11): 1235-1242 - URL: https://www.wjgnet.com/1007-9327/full/v18/i11/1235.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i11.1235