BPG is committed to discovery and dissemination of knowledge
Brief Article
Copyright ©2011 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 21, 2011; 17(7): 938-945
Published online Feb 21, 2011. doi: 10.3748/wjg.v17.i7.938
Table 1 Primers used for reverse transcription-polymerase chain reaction
GenePrimer (5’-3’)
Amplicon(bp)
Forward primerReverse primer
ALBCTTTCAAAGCATGGGCAGTAGGCAGCAGCACGACAGAGTAA411
GATA-4ACCTGGGACTTGGAGGATAGGACAAGGACATCTTGGGAAA250
AFPTGAGCACTGTTGCAGAGGAGCTGAGACAGCAAGCTGAGGA308
Table 2 Changes in serum biochemical indexes at different times
48 h after injection D-GalN
48 h after transplantation
7 d after transplantation
All 3 groupsEncapsulated groupUnencapsulated groupPBS groupEncapsulated groupUnencapsulated groupPBS group
ALT (U/L)3242.3 ± 2403.2493.93 ± 63.45b126.1 ± 54.35245.9 ± 67.8742.25 ± 11.8645.07 ± 10.5647.27 ± 11.08
AST (U/L)4237.20 ± 1372.07168.87 ± 89.33b275.7 ± 52.74439.7 ± 133.01162.6 ± 54.29124.52 ± 24.61114.83 ± 16.50
TBIL (μmol/L)5.57 ± 1.861.73 ± 1.01a2.23 ± 1.983.50 ± 1.231.90 ± 0.522.72 ± 0.963.72 ± 1.18