©2011 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 14, 2011; 17(6): 796-803
Published online Feb 14, 2011. doi: 10.3748/wjg.v17.i6.796
Published online Feb 14, 2011. doi: 10.3748/wjg.v17.i6.796
Table 1 Microarray analysis showing clinical characteristics of biliary atresia patients
| Case No. | Gender | Age | TB/DB | ALT/AST | AKP/GGT | Albumin | Disease | Group |
| 1 | Female | 50 d | 171/130 | 132/254 | 604/609 | 35.8 | BA | 1 |
| 2 | Male | 49 d | 291/231 | 148/155 | 581/408 | 39.4 | BA | 1 |
| 3 | Male | 57 d | 148/117 | 189/166 | 493/535 | 35.2 | BA | 1 |
| 4 | Female | 73 d | 145/118 | 111/153 | 460/1460 | 36.3 | BA | 2 |
| 5 | Male | 84 d | 160/127 | 100/149 | 713/1278 | 37.3 | BA | 2 |
| 6 | Female | 66 d | 129/108 | 121/165 | 632/1235 | 39.2 | BA | 2 |
| 7 | Female | 103 d | 151/112 | 85/62 | 451/360 | 39.4 | BA | 3 |
| 8 | Female | 97 d | 118/89 | 74/78 | 522/501 | 34.3 | BA | 3 |
| 9 | Male | 110 d | 155/121 | 105/97 | 377/912 | 35.4 | BA | 3 |
| 10 | Female | 77 d | 102/89 | 201/137 | 234/317 | 39.4 | Cholestasis | 4 |
| 11 | Male | 64 d | 137/108 | 404/267 | 584/1044 | 37.2 | Cholestasis | 4 |
| 12 | Female | 55 d | 144/112 | 389/266 | 612/1339 | 41.0 | Cholestasis | 4 |
| 13 | Male | 4 yr | 16/9 | 33/35 | 200/50 | 39.4 | Liver trauma | 5 |
| 14 | Male | 6 yr | 10/4 | 20/25 | 192/44 | 40.1 | Liver trauma | 5 |
| 15 | Male | 4 yr | 12/4.7 | 29/37 | 101/38 | 37.1 | Liver trauma | 5 |
Table 2 Sequences of primers in selected genes used in reverse-transcription polymerase chain reaction
| Gene name | Primer sequences |
| RRAS | F: TTGGTCGGGAACAAGGCAGAT |
| R: CTCGTCCACGTTGAGACGCAGT | |
| POMC | F: GAGAGCAGCCAGTGTCAGG |
| R: GAAGTGGCCCATGACGTACT | |
| SLC26A6 | F: CGGTATCCTGTGCGTGACT |
| R: GGAAGTGCCAAACAGGAAGT | |
| STX3 | F: GGCAAAAAGACAACCGATGA |
| R: TGTCGTGAAGCTCCTTGATG | |
| β-actin | F: GGGAAATCGTGCGTGCATT |
| R: CAGGCAGCTCGTAGCTCTT |
Table 3 Significant pathways involved in pathogenesis of biliary atresia
| Pathway name | P value | Profile No. |
| Cell adhesion molecules | 0.000118 | Profile49 |
| Regulation of actin cytoskeleton | 0.000739 | Profile49 |
| T Leukocyte transendothelial migration | 0.001738 | Profile49 |
| Asthma | 0.002023 | Profile49 |
| Allograft rejection | 0.003243 | Profile49 |
| Systemic lupus erythematosus | 2.44E-05 | Profile74 |
| Lysosome | 0.0002109 | Profile74 |
| NF-kappa B signaling pathway | 0.0036605 | Profile74 |
| MAPK signaling pathway | 0.0052322 | Profile74 |
| Allograft rejection | 0.0058515 | Profile74 |
| Graft-versus-host disease | 0.0071277 | Profile74 |
| Type I diabetes mellitus | 0.00781 | Profile74 |
| Chemokine signaling pathway | 1.81E-08 | Profile75 |
| Matrix_Metalloproteinases | 6.52E-07 | Profile75 |
| Cytokine-cytokine receptor interaction | 3.59E-05 | Profile75 |
| T cell receptor signaling pathway | 4.34E-05 | Profile75 |
| Antigen processing and presentation | 0.000337 | Profile75 |
| Leukocyte transendothelial migration | 0.0010211 | Profile75 |
| Lysosome | 2.09E-07 | Profile76 |
| Toll-like receptor signaling pathway | 0.000284 | Profile76 |
| T cell receptor signaling pathway | 0.000388 | Profile76 |
| Chemokine signaling pathway | 0.000755 | Profile76 |
| Asthma | 0.000841 | Profile76 |
| Matrix_Metalloproteinases | 0.001402 | Profile76 |
| Allograft rejection | 0.001697 | Profile76 |
Table 4 Genes with the highest degree and k-core in dynamic gene networks
| Gene symbol | Definition | Degree | k-core |
| RRAS | Homo sapiens related RAS viral (r-ras) oncogene homolog (RRAS), mRNA | 12 | 6 |
| POMC | Homo sapiens POMC, transcript variant 1, mRNA | 12 | 6 |
| SLC26A6 | Homo sapiens SLC26A6, transcript variant 3, mRNA | 12 | 6 |
| STX3 | Homo sapiens STX3, mRNA | 10 | 6 |
Table 5 Reverse-transcription polymerase chain reaction showing relative expression levels of RRAS, POMC, SLC26A6 and STX3 (mean ± SD)
| Group | POMC | SLC26A6 | RRAS | STX3 |
| Biliary atresia (n = 40) | 0.58 ± 0.090 | 0.43 ± 0.054 | 0.89 ± 0.103 | 0.61 ± 0.074 |
| Neonatal cholestasis (n = 14) | 0.41 ± 0.081 | 0.30 ± 0.029 | 0.47 ± 0.074 | 0.51 ± 0.045 |
| P-value | 0.031 | 0.023 | 0.004 | 0.017 |
Table 6 Fibrosis scores for different groups of biliary atresia patients at different ages
| Group | Fibrosis score (n) | Total | ||||
| 0 | 1 | 2 | 3 | 4 | ||
| < 60 d | 1 | 3 | 8 | 2 | 0 | 14 |
| 60-90 d | 0 | 2 | 3 | 6 | 4 | 15 |
| > 90 d | 0 | 0 | 1 | 4 | 6 | 11 |
| Total | 1 | 5 | 12 | 12 | 10 | 40 |
- Citation: Zhao R, Li H, Shen C, Zheng S. RRAS: A key regulator and an important prognostic biomarker in biliary atresia. World J Gastroenterol 2011; 17(6): 796-803
- URL: https://www.wjgnet.com/1007-9327/full/v17/i6/796.htm
- DOI: https://dx.doi.org/10.3748/wjg.v17.i6.796
