Copyright
©2011 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 7, 2011; 17(1): 118-122
Published online Jan 7, 2011. doi: 10.3748/wjg.v17.i1.118
Published online Jan 7, 2011. doi: 10.3748/wjg.v17.i1.118
Table 1 The primers for NOD2/CARD15 gene
| SNPs | Primers | Length of products (bp) |
| Arg702Trp | Forward5’CTTCCTGGCAGGGCTGTTGTC3’ | 176 |
| Reverse5’CATGCACGCTCTTGGCCTCAC3’ | ||
| Gly908Arg | Forward 5’AAGTCTGTAATGTAAAGCCAC3’ | 380 |
| Reverse 5’CCCAGCTCCTCCCTCTTC3’ | ||
| Leu1007fsinsC | Forward 5’CCTGCAGTCTCTTTAACTGG3’ | 168 |
| Reverse 5’CTTACCAGACTTCCAGGATG3’ |
Table 2 The single nucleotide polymorphisms, restriction enzymes and products of NOD2 gene
| SNPs | Polymorphic alleles | Restriction enzymes | Wild-type alleles (bp) | Mutant alleles (bp) |
| Arg702Trp | C2104T | MspI | 76 + 54 + 24 + 22 | 130 + 24 + 22 |
| Gly908Arg | G2722C | HhaI | 380 | 242 + 138 |
| Leu1007fsinsC | 3020insC | NlaIV | 168 | 128 + 40 |
Table 3 Univariate logistic regression analysis of risk factors for inflammatory bowel disease
| Variables | χ2 | P | RR | 95% CI | |
| Lower bound | Upper bound | ||||
| Habitat condition during the past 5 yr | 1.192 | 0.274 | 0.653 | 0.303 | 1.404 |
| Educational background | 1.250 | 0.265 | 0.724 | 0.284 | 1.528 |
| Occupation classification | 0.894 | 0.293 | 0.615 | 0.314 | 1.412 |
| Alcoholic drinking | 0.987 | 0.361 | 0.712 | 0.194 | 1.512 |
| Cigarette smoking | 1.215 | 0.194 | 0.843 | 0.247 | 1.384 |
| Tea drinking | 1.523 | 0.165 | 0.631 | 0.315 | 1.423 |
| Stress | 18.452 | < 0.001 | 1.295 | 1.151 | 1.457 |
| Milk intake | 25.425 | < 0.001 | 1.279 | 1.162 | 1.407 |
| Fried food intake | 24.378 | < 0.002 | 1.286 | 1.154 | 1.417 |
Table 4 Multivariate logistic regression analysis of risk factors for inflammatory bowel disease
| Variables | χ2 | P | RR | 95% CI | |
| Lower bound | Upper bound | ||||
| Milk intake | 10.713 | 0.0011 | 1.243 | 1.091 | 1.415 |
| Fried food intake | 14.267 | 0.0002 | 1.238 | 1.108 | 1.383 |
| Stress | 13.377 | 0.0003 | 1.241 | 1.102 | 1.394 |
- Citation: Wang ZW, Ji F, Teng WJ, Yuan XG, Ye XM. Risk factors and gene polymorphisms of inflammatory bowel disease in population of Zhejiang, China. World J Gastroenterol 2011; 17(1): 118-122
- URL: https://www.wjgnet.com/1007-9327/full/v17/i1/118.htm
- DOI: https://dx.doi.org/10.3748/wjg.v17.i1.118
