©2010 Baishideng Publishing Group Co.
World J Gastroenterol. Nov 7, 2010; 16(41): 5211-5224
Published online Nov 7, 2010. doi: 10.3748/wjg.v16.i41.5211
Published online Nov 7, 2010. doi: 10.3748/wjg.v16.i41.5211
Table 1 Primer used for quantitative real-time polymerase chain reaction validation of array results
| Gene | Probe set ID | Forward | Reverse |
| CYP4B1 | M29853 | 5'CCGAAGGCTGCAGATGTGT3' | 5'TTTGGCCCATCCAGAACTAGTAG3' |
| mSmad7 | 5'GGTGCTCAAGAAACTCAAGG3' | 5'CAGCCTGCAGTCCAGGCG3' | |
| BMP2 | L02678_at | 5'TGCCCCCTAGTGCTTCTTAGAC3' | 5'GGGAAGCAGCAACACTAGAAGAC3' |
| SGIII | U02983 | 5'CAAGCAGGACCGAGAATCAG3' | 5'CGTTGGACAAGGTCAAGGTG3' |
| Zfp423 | U92564 | 5'GCAGTGCTACACCTGACTCG3' | 5'GTCATCCCGCATCTTCTTCTG3' |
| Pla2g2a | x51529 | 5'GCTCAATTCAGGTCCAGGG3' | 5'CCACCCACACCACAATGG3' |
| EST189231 | AA799734 | 5'CGGCTCACTGAGCTTGAAGTAG3' | 5'ACACGACGGAGGAGCTTCTG3' |
| Olr1 | AB005900 | 5'CAGAGAGAACTGAAGGAACAG3' | 5'GGACCTGAAGAGTTTGCAGC3' |
| ID1 | L23148_g_at | 5'TGGACGAACAGCAGGTGAAC3' | 5'TCTCCACCTTGCTCACTTTGC3' |
| HK2 | D26393exon_s_at | 5'CTCAGAGCGCCTCAAGACAAG3' | 5'GATGGCACGAACCTGTAGCA3' |
| Slc16a3 | U87627 | 5'CTCATCGGACCCCCATCAG3' | 5'CGCCAGGATGAACACATACTTG3' |
| ratVEGF.1 | 5'TGCCAAGTGGTCCCAGGC3' | 5'ATTGGACGGCAATAGCTGCG3' |
Table 2 One hundred genes selected as being differentially expressed after Smad7 overexpression in hepatic stellate cells (note that some specific transcripts are detected by more than one probe set)
| Official symbol | Average log2 fold | SD log2 fold | Affymetrix probe set ID | Official full name |
| Downregulated (n = 72) | ||||
| Acta2 | -0.85 | 0.21 | X06801cds_i_at | Smooth muscle α-actin |
| Ak3l1 | -1.20 | 0.42 | rc_AA891949_at | Adenylate kinase 3-like 1 |
| Akap12 | -1.00 | 0.57 | U75404UTR#1_s_at | A kinase (PRKA) anchor protein (gravin) 12 |
| Akr1b1 | -0.70 | 0.42 | M60322_g_at | Aldo-keto reductase family 1, member B1 (aldose reductase) |
| Atp6v1b2 | -1.10 | 0.14 | Y12635_at | ATPase, H transporting, lysosomal V1 subunit B2 |
| Btg1 | -0.65 | 0.49 | L26268_g_at | B-cell translocation gene 1, anti-proliferative |
| Clec4f | -2.40 | 3.39 | M55532_at | C-type lectin domain family 4, member f |
| Cml5 | -1.30 | 0.42 | rc_AA894273_at | Camello-like 5 |
| Cnn1 | -1.30 | 0.57 | D14437_s_at | Calponin 1 |
| Col1a1 | -1.51 | 0.53 | M27207mRNA_s_at/rc_AI231472_s_at/U75405UTR#1_f_at/Z78279_at/Z78279_g_at | Procollagen, type 1, α 1 |
| Cryab | -1.13 | 0.32 | M55534mRNA_s_at/X60351cds_s_at | Crystallin, α B |
| Cyp1b1 | -1.10 | 0.28 | rc_AI176856_at/U09540_at/U09540_g_at | Cytochrome P450, family 1, subfamily b, polypeptide 1 |
| Ddah1 | -0.95 | 0.21 | D86041_at | Dimethylarginine dimethylaminohydrolase 1 |
| Dpysl2 | -0.95 | 0.64 | rc_AA875444_at | Dihydropyrimidinase-like 2 |
| Egr2 | -1.25 | 0.64 | U78102_at | Early growth response 2 |
| Eif4ebp1 | -1.05 | 0.07 | U05014_at | Eukaryotic translation initiation factor 4E binding protein 1 |
| Emp1 | -0.65 | 0.78 | Z54212_at | Epithelial membrane protein 1 |
| Eno2 | -0.80 | 0.71 | X07729exon#5_s_at | Enolase 2, γ |
| Ercc1 | -0.75 | 0.49 | rc_AA892791_at | Excision repair cross-complementing rodent repair deficiency, complementation group 1 |
| EST (unknown) | -2.65 | 0.64 | rc_AI102814_at | EST |
| EST (unknown) | -2.60 | 0.28 | rc_AI230256_at | EST |
| EST (unknown) | -2.00 | 0.14 | rc_AA874889_g_at | EST |
| EST (unknown) | -1.40 | 0.85 | rc_AA866419_at | EST |
| EST (unknown) | -1.35 | 0.64 | X62950mRNA_f_at | EST |
| EST (unknown) | -1.10 | 0.99 | rc_AA859740_at | EST |
| EST (unknown) | -0.85 | 0.35 | rc_AA800708_at | EST |
| EST (unknown) | -0.40 | 1.41 | X62951mRNA_s_at | EST |
| F3 | -1.85 | 0.92 | U07619_at | Coagulation factor III |
| Fabp5 | -0.80 | 0.57 | S69874_s_at | Fatty acid binding protein 5, epidermal |
| Fkbp1a | -0.65 | 0.49 | rc_AI228738_s_at | FK506 binding protein 1a |
| Fn1 | -1.15 | 0.36 | L00190cds#1_s_at/U82612cds_g_at/X05834_at | Fibronectin 1 |
| Fntb | -1.28 | 0.49 | rc_AI136396_at/rc_AI230914_at | Farnesyltransferase, CAAX box, β |
| Gabbr1 | -1.25 | 0.92 | rc_AI639395_at | γ-aminobutyric acid (GABA) B receptor 1 |
| Gpx3 | -1.10 | 0.14 | D00680_at | Glutathione peroxidase 3 |
| Hig1 | -0.95 | 0.49 | rc_AA891422_at | Hypoxia induced gene 1 |
| Hk2 | -3.20 | 0.00 | D26393exon_s_at | Hexokinase 2 |
| Id1 | -2.55 | 0.35 | L23148_g_at | Inhibitor of DNA binding 1 |
| Id2 | -2.45 | 0.21 | rc_AI137583_at | Inhibitor of DNA binding 2 |
| Id3 | -1.85 | 0.13 | AF000942_at/rc_AI009405_s_at | Inhibitor of DNA binding 3 |
| Idi1 | -0.70 | 0.57 | AF003835_at | Isopentenyl-diphosphate delta isomerase |
| LOC686781 | -1.25 | 0.21 | rc_AA799657_at | Similar to NFκB interacting protein 1 |
| Lox | -1.10 | 0.17 | rc_AA875582_at/rc_AI234060_s_at/S77494_s_at | Lysyl oxidase |
| Lpl | -1.20 | 0.71 | L03294_at/L03294_g_at/rc_AI237731_s_at | Lipoprotein lipase |
| Lrrc59 | -0.65 | 0.64 | D13623_at | Leucine rich repeat containing 59 |
| Lum | -0.80 | 0.42 | X84039_at | Lumican |
| Ncam1 | -1.35 | 0.78 | X06564_at | Neural cell adhesion molecule 1 |
| Olr1 | -2.43 | 0.99 | AB005900_at/AB018104cds_s_at/rc_AI071531_s_at | Oxidized low density lipoprotein (lectin-like) receptor 1 |
| P4ha1 | -0.85 | 0.21 | X78949_at | Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), α 1 polypeptide |
| Pcsk6 | -1.10 | 0.71 | rc_AI230712_at | Proprotein convertase subtilisin/kexin type 6 |
| Pfkp | -1.25 | 0.54 | L25387_at/L25387_g_at | Phosphofructokinase, platelet |
| Plaur | -1.20 | 0.71 | X71898_at | Plasminogen activator, urokinase receptor |
| Plod2 | -1.00 | 0.28 | rc_AA892897_at | Procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 |
| Pmepa1 | -1.55 | 0.07 | rc_AI639058_s_at | Prostate transmembrane protein, androgen induced 1 |
| Ptk2 | -0.85 | 0.35 | S83358_s_at | PTK2 protein tyrosine kinase 2 |
| Rasl11a | -2.25 | 0.49 | rc_AI169372_at | RAS-like family 11 member A |
| Rasl11b | -1.03 | 0.24 | rc_AA800853_at/rc_AA800853_g_at | RAS-like family 11 member B |
| Rcn2 | -0.90 | 0.57 | U15734_at | Reticulocalbin 2 |
| RGD1306841 | -1.10 | 0.14 | rc_AI639203_at | Similar to RIKEN cDNA 2410006F12 |
| RGD1310444_predicted | -1.25 | 0.21 | rc_AA866432_at | LOC363015 (predicted) |
| Rgs4 | -1.45 | 0.64 | U27767_at | Regulator of G-protein signaling 4 |
| Sc4mol | -1.10 | 0.45 | E12625cds_at/rc_AI172293_at | Sterol-C4-methyl oxidase-like |
| Schip1 | -1.00 | 0.42 | rc_AA800036_at | Schwannomin interacting protein 1 |
| Serpine1 | -1.90 | 0.00 | M24067_at | Serine (or cysteine) peptidase inhibitor, clade E, member 1 |
| Slc12a2 | -0.80 | 0.99 | AF051561_s_at | Solute carrier family 12, member 2 |
| Slc16a3 | -2.05 | 0.35 | U87627_at | Solute carrier family 16 (monocarboxylic acid transporters), member 3 |
| Slc2a1 | -1.15 | 0.35 | S68135_s_at | Solute carrier family 2 (facilitated glucose transporter), member 1 |
| Spink8 | -2.55 | 1.48 | rc_AA799734_at | Serine peptidase inhibitor, kazal type 8 |
| Tfrc | -0.90 | 0.42 | M58040_at | Transferrin receptor |
| Tnc | -0.90 | 0.28 | U09401_s_at | Tenascin C |
| Tnnt2 | -1.70 | 0.42 | M80829_at | Troponin T2, cardiac |
| Vegfa | -2.25 | 1.28 | L20913_s_at/M32167_g_at/rc_AA850734_at | Vascular endothelial growth factor A |
| Wfdc1 | -1.70 | 0.14 | AF037272_at | WAP four-disulfide core domain 1 |
| Up-regulated (n = 28) | ||||
| Adora2a | 0.85 | 0.35 | S47609_s_at | Adenosine A2a receptor |
| Agtr1a | 0.95 | 0.21 | M74054_s_at/X62295cds_s_at | Angiotensin II receptor, type 1 (AT1A) |
| Bmp2 | 2.83 | 1.31 | L02678_at/rc_AA997410_s_at | Bone morphogenetic protein 2 |
| Col3a1 | 0.90 | 0.42 | M21354_s_at/X70369_s_at/ | Procollagen, type III, α 1 |
| Cxcl10 | 1.05 | 0.21 | U17035_s_at | Chemokine (C-X-C motif) ligand 10 |
| Cyp2e1 | 1.00 | 0.14 | M20131cds_s_at | Cytochrome P450, family 2, subfamily e, polypeptide 1 |
| Cyp4b1 | 3.25 | 0.49 | M29853_at | Cytochrome P450, family 4, subfamily b, polypeptide 1 |
| Ednrb | 0.70 | 0.42 | rc_AA818970_s_at | Endothelin receptor type B |
| Ephx1 | 1.15 | 0.21 | M26125_at | Epoxide hydrolase 1, microsomal |
| EST (unknown) | 0.80 | 0.28 | rc_AA874873_g_at | EST |
| EST (unknown) | 0.90 | 0.28 | rc_AI177256_at | EST |
| Glul | 0.90 | 0.23 | M91652complete_seq_at/rc_AA852004_s_at | Glutamate-ammonia ligase (glutamine synthase) |
| Hgf | 1.03 | 0.05 | E03190cds_s_at/X54400_r_at | Hepatocyte growth factor |
| Hsd11b1 | 0.95 | 0.49 | rc_AI105448_at | Hydroxysteroid 11-β dehydrogenase 1 |
| Igfbp3 | 1.15 | 0.30 | M31837_at | Insulin-like growth factor binding protein 3 |
| Kif4 | 1.05 | 0.07 | rc_AA859926_at | Kinesin family member 4 |
| Lhx2 | 0.95 | 0.21 | L06804_at | LIM homeobox protein 2 |
| Notch1 | 0.80 | 0.42 | X57405_g_at | Notch gene homolog 1 (Drosophila) |
| Nr2f1 | 0.95 | 0.21 | U10995_g_at | Nuclear receptor subfamily 2, group F, member 1 |
| Pdcd4 | 1.00 | 0.14 | rc_AI172247_at | Programmed cell death 4 |
| Pdgfra | 1.10 | 0.28 | rc_AI232379_at | Platelet derived growth factor receptor, α polypeptide |
| Pla2g2a | 3.60 | 0.00 | X51529_at | Phospholipase A2, group IIA (platelets, synovial fluid) |
| Ptn | 2.10 | 0.57 | rc_AI102795_at | Pleiotrophin |
| Scg3 | 2.70 | 0.85 | U02983 | Secretogranin III |
| Serping1 | 0.85 | 0.21 | rc_AA800318_at | Serine (or cysteine) peptidase inhibitor, clade G, member 1 |
| Smad7 | 5.35 | 1.20 | AF042499_at | MAD homolog 7 (Drosophila) |
| Sod3 | 1.05 | 0.07 | Z24721_at | superoxide dismutase 3, extracellular |
| Zfp423 | 1.85 | 1.47 | U92564_at/U92564_g_at | Zinc finger protein 423 |
Table 3 Comparison of gene regulation in activated hepatic stellate cells in vivo (De Minicis et al[13])
| Gene symbol | Smad7 overexpressing HSCs | In vivo activated untransformed HSCs |
| Acta2 | ↓ | ↑ |
| BMP21 | ↑ | ↓ |
| Cnn1 | ↓ | ↑ |
| Col1a1 | ↓ | ↑ |
| Col3a1 | ↑ | ↑ |
| Cryab | ↓ | ↓ |
| Cyp1b1 | ↓ | ↑ |
| Ddah1 | ↓ | ↑ |
| Ednrb | ↑ | ↑2 |
| Eno2 | ↓ | ↓ |
| Ephx1 | ↑ | ↑2 |
| Fn1 | ↓ | ↑ |
| Gabbr1 | ↓ | ↓ |
| Hgf | ↑ | ↑2 |
| Hk21 | ↓ | ↑ |
| Hsd11b1 | ↑ | ↑2 |
| Id1 | ↓ | ↓ |
| Igfbp3 | ↑ | ↑2 |
| Kif4 | ↑ | ↑ |
| Lox | ↓ | ↑ |
| Lpl | ↓ | ↑2 |
| Lum | ↓ | ↑ |
| Ncam1 | ↓ | ↑ |
| P4ha1 | ↓ | ↑ |
| Pdgfra | ↑ | ↓ |
| Pfkp | ↓ | ↑ |
| Plod2 | ↓ | ↑ |
| Rasl11b | ↓ | ↑ |
| Serping1 | ↑ | ↑ |
| Slc16a3 | ↓ | ↑ |
| Slc2a1 | ↓ | ↑ |
| Sod3 | ↑ | ↑ |
| Tmepai_predicted | ↓ | ↓2 |
| Tnc | ↓ | ↓2 |
| Tnnt2 | ↓ | ↑ |
| VEGFa1 | ↓ | ↑ (VEGFc)1 |
| Wfdc1 | ↓ | ↑2 |
Table 4 Comparison of gene regulation according to quantitative real-time polymerase chain reaction analysis and array analysis
| Gene | Probe set ID | Array | RT-PCR analysis |
| Cyp4B1 | M29853_at | Up | Up |
| Smad7 | AF042499_at | Up | Up |
| BMP2 | L02678_at/rc_AA997410_s_at | Up | Up |
| SGIII | U02983_at | Up | Up |
| Zfp423 | U92564_at/U92564_g_at | Up | Up |
| Pla2g2a | x51529_at | Up | Up |
| EST189231 | AA799734_at | Down | Down |
| Olr1 | AB005900_at/ AB018104cds_s_at/ rc_AI071531_s_at | Down | Down |
| ID1 | L23148_g_at | Down | Down |
| HK2 | D26393exon_s_at | Down | 3 d down/7 d up |
| Slc16a3 | U87627_at | Down | 3 d down/7 d up |
| VEGFa/ratVEGF.1 in RT-PCR | L20913_s_at/M32167_g_at | Down | 3 d down/7 d up |
- Citation: Denecke B, Wickert L, Liu Y, Ciuclan L, Dooley S, Meindl-Beinker NM. Smad7 dependent expression signature highlights BMP2 and HK2 signaling in HSC transdifferentiation. World J Gastroenterol 2010; 16(41): 5211-5224
- URL: https://www.wjgnet.com/1007-9327/full/v16/i41/5211.htm
- DOI: https://dx.doi.org/10.3748/wjg.v16.i41.5211
