Up-regulation of PIK3CA promotes metastasis in gastric carcinoma

Table 1 Primers used in real-time quantitative polymerase chain reaction

Primer	Nucleotide sequence (5’→3’)
PIK3CA (+)	TGCTAAAGAGGAACACTGTCCA
PIK3CA (-)	GGTACTGGCCAAAGATTCAAAG
β-actin (+)	CTGAGCAGATCATGAAGAC
β-actin (-)	CTTGGTGGACGCATCCTGAG

“+” and “-” mean sense and antisense oligos, respectively.

Table 2 Difference of PIK3CA protein expression among normal gastric mucosa, primary, lymph node metastasis and distant metastasis in gastric cancer

Tissues	PIK3CA staining			Total	P
	0-1	2-4	5-6
Normal	10	0	0	10	0.036a
Primary	13	6	1	20	0.015b
Lymph node metastasis	5	3	7	15	0.044c
Distant metastasis	7	3	6	18	0.537d

^aP < 0.05, normal vs primary;

^bP < 0.05, primary vs lymph node metastasis;

^cP < 0.05, primary vs distant metastasis;

^dP > 0.05, lymph node metastasis vs distant metastasis, all by Mann-Whitney U test.

Table 3 Correlation between PIK3CA expression and clinicopathological characteristics in gastric carcinoma

Variables	PIK3CA expression
	n	Positive	Negative	χ2	P
Gender
Male	29	17	12	0.862	0.834a
Female	24	11	13
Age (yr)
≥ 60	32	16	16	0.256	0.968a
< 60	21	12	9
TNM stage
I, II	20	7	13	4.926	0.177a
III, IV	33	21	12
Differentiation
Well	22	7	15	6.685	0.083a
Moderate and poor	31	21	10
Lymph node metastasis
Negative	26	8	18	9.982	0.019ab
Positive	27	20	7
Distant metastasis
Negative	35	17	18	0.749	0.862a
Positive	18	11	7

^aχ² test;

^bThe value is significant.