Copyright
©2010 Baishideng Publishing Group Co.
World J Gastroenterol. Oct 7, 2010; 16(37): 4685-4690
Published online Oct 7, 2010. doi: 10.3748/wjg.v16.i37.4685
Published online Oct 7, 2010. doi: 10.3748/wjg.v16.i37.4685
Table 1 Conditions and products of polymerase chain reaction followed by restriction fragment length polymorphism
Gene | Primers | Tm (°C) | RE | bp | Alleles |
ApoB | Forward: GGAGACTATTCAGAAGCTAA | 55 | XbaI | 710 | X-: 710 bp |
Reverse: GAAGAGCCTGAAGACTGACT | X+: 433 and 277 bp | ||||
ApoE | Forward: ACAGAATTCGCCCCGGCCTGGTACAC | 60 | HhaI | 252 | E2: 91 and 84 bp |
Reverse: TAAGCTTGGCACGGCTGTCCAAGGA | E3: 91, 48 and 36 pb | ||||
E4: 72, 48 and 36 bp | |||||
CYP7A1 | Forward: CAGAGCATGGACAGGGAGCAG | 55 | BsaI | 948 | A: 581, 367 bp |
Reverse: GCAACTCCTCATGGCTGAGGTT | C: 542, 367 and 39 bp |
Table 2 Clinical characteristics in control subjects and patients with gallstones (mean ± SD)
Variable | Patients (n = 101) | Controls (n = 101) | P |
Sex (F/M) | 86.10%/13.90% | 86.10%/13.90% | 1.000 |
Age (yr) | 51.93 ± 11.23 | 51.74 ± 10.99 | 0.904 |
Body mass index (kg/m2) | 29.03 ± 4.19 | 27.63 ± 4.42 | 0.024 |
Serum glucose (mg/dL) | 120.24 ± 44.20 | 100.30 ± 34.64 | 0.000 |
Lipids (mg/dL) | 622.00 ± 149.77 | 688.60 ± 160.68 | 0.003 |
Cholesterol (mg/dL) | 187.32 ± 45.10 | 208.21 ± 43.14 | 0.001 |
LDL cholesterol (mg/dL) | 118.58 ± 41.64 | 130.94 ± 33.80 | 0.022 |
Triglycerides (mg/dL) | 119.76 ± 87.05 | 144.45 ± 72.22 | 0.029 |
HDL cholesterol (mg/dL) | 43.27 ± 13.26 | 46.56 ± 14.01 | 0.089 |
Cholesterol in stones (% by weight) | 99.23 ± 2.50 |
Table 3 Allelic (af) and genotypic (gf) frequencies of ApoB-100, ApoE and CYP7A1 polymorphisms in patients with gallstones and controls
Polymorphism | Patients (n = 101) | Controls (n = 101) | P value | OR | 95% CI | ||
ApoB-100 XbaI | |||||||
Alleles | n | af | n | af | |||
X- | 133 | 65.84% | 118 | 58.42% | 0.124 | 1.37 | 0.92-2.05 |
X+ | 69 | 34.16% | 84 | 41.58% | 0.124 | 0.73 | 0.49-1.09 |
Genotypes | n | gf | n | gf | |||
X-X- | 41 | 40.59% | 34 | 33.66% | 0.308 | 1.35 | 0.76-2.39 |
X+X- | 51 | 50.50% | 50 | 49.50% | 0.888 | 1.04 | 0.60-1.81 |
X+X+ | 9 | 8.91% | 17 | 16.83% | 0.093 | 0.48 | 0.20-1.14 |
ApoE HhaI | |||||||
Alleles | n | af | n | af | |||
E2 | 9 | 4.46% | 12 | 5.94% | 0.501 | 0.74 | 0.30-1.79 |
E3 | 173 | 85.64% | 158 | 78.22% | 0.052 | 1.66 | 0.99-2.78 |
E4 | 20 | 9.90% | 32 | 15.84% | 0.075 | 0.58 | 0.32-1.06 |
Genotypes | n | gf | n | gf | |||
E2E2 | 0 | 0.00% | 1 | 0.99% | NC | NC | NC |
E3E3 | 74 | 73.27% | 64 | 63.37% | 0.130 | 1.58 | 0.87-2.88 |
E4E4 | 1 | 0.99% | 2 | 1.98% | 0.561 | 0.50 | 0.04-5.55 |
E2E3 | 8 | 7.92% | 6 | 5.94% | 0.580 | 1.36 | 0.45-4.08 |
E2E4 | 1 | 0.99% | 4 | 3.96% | 0.174 | 0.24 | 0.03-2.21 |
E3E4 | 17 | 16.83% | 24 | 23.76% | 0.221 | 0.65 | 0.32-1.30 |
CYP7A1 BsaI | |||||||
Alleles | n | af | n | af | |||
A | 150 | 74.26% | 146 | 72.28% | 0.653 | 1.11 | 0.71-1.72 |
C | 52 | 25.74% | 56 | 27.72% | 0.653 | 0.90 | 0.58-1.40 |
Genotypes | n | gf | n | gf | |||
AA | 59 | 58.42% | 56 | 55.45% | 0.670 | 1.13 | 0.65-1.97 |
CA | 32 | 31.68% | 34 | 33.66% | 0.764 | 0.91 | 0.51-1.65 |
CC | 10 | 9.90% | 11 | 10.89% | 0.818 | 0.90 | 0.36-2.22 |
- Citation: Jaime SC, Maribel AM, Eliakym AM, José RN, Julio G, Laura SM, Rosalío RP. ApoB-100, ApoE and CYP7A1 gene polymorphisms in Mexican patients with cholesterol gallstone disease. World J Gastroenterol 2010; 16(37): 4685-4690
- URL: https://www.wjgnet.com/1007-9327/full/v16/i37/4685.htm
- DOI: https://dx.doi.org/10.3748/wjg.v16.i37.4685