copy;2010 Baishideng Publishing Group Co.
World J Gastroenterol. Sep 7, 2010; 16(33): 4135-4144
Published online Sep 7, 2010. doi: 10.3748/wjg.v16.i33.4135
Published online Sep 7, 2010. doi: 10.3748/wjg.v16.i33.4135
Table 1 Primers used in the study
| Primer | # bases | Sequence (5’ to 3’) | Species with identical match (%) |
| Forward primers | |||
| 8F | 20 | AGAGTTTGATCCTGGCTCAG | n/a1 |
| 343F | 15 | TACGGRAGGCAGCAG | 99.1 |
| 517F | 17 | GCCAGCAGCCGCGGTAA | 93.2 |
| 784F | 15 | AGGATTAGATACCCT | 90.0 |
| 917F | 16 | GAATTGACGGGGRCCC | 84.0 |
| 1099F | 16 | GYAACGAGCGCAACCC | 73.1 |
| Reverse primers | |||
| 534R | 18 | ATTACCGCGGCTGCTGGC | 91.8 |
| 798R | 15 | AGGGTATCTAATCCT | 90.0 |
| 926R | 20 | CCGTCAATTYYTTTRAGTTT | 83.0 |
| 1114R | 16 | GGGTTGCGCTCGTTRC | 74.9 |
| 1407R | 16 | GACGGGCGGTGTGTRC | 91.3 |
| 1541R | 20 | AAGGAGGTGATCCAGCCGCA | n/a1 |
Table 2 Amplicons designed for analysis
| Amplicon | Primers | Total length | HVR(s) included | |
| F | R | |||
| A | 8F | 534R | 527 | 1,2,3 |
| B | 343F | 798R | 456 | 3,4 |
| C | 517F | 926R | 410 | 3,4,5 |
| D | 784F | 1114R | 331 | 5,6 |
| E | 917F | 1407R | 491 | 6,7 |
| F | 1099F | 1541R | 443 | 7,8,9 |
Table 3 Accuracy of taxonomic classification of 219 foregut species using 350-bp sequences
| Amplicon | % accuracy compared to 900-bp amplicon/full length | ||||
| Phylum | Class | Order | Family | Genus | |
| Forward reads | |||||
| A | 97.7/97.7 | 96.3/95.9 | 95.9/95.4 | 93.2/94.5 | 87.7/86.8 |
| B | 99.1/99.1 | 98.2/96.8 | 97.7/96.3 | 97.3/95.9 | 91.8/89.0 |
| C | 99.5/99.5 | 98.2/96.8 | 97.7/96.8 | 97.3/95.9 | 90.4/88.1 |
| D | 98.6/99.1 | 98.6/98.2 | 97.3/97.3 | 95.9/96.3 | 88.1/86.8 |
| E | 98.2/98.6 | 97.7/98.2 | 95.4/95.9 | 92.2/93.6 | 85.4/84.9 |
| F | 97.7/98.2 | 96.3/97.3 | 95.0/95.4 | 91.8/93.6 | 83.6/84.5 |
| Reverse reads | |||||
| A’ | 98.6/98.6 | 97.3/97.7 | 97.3/97.7 | 95.0/96.3 | 90.0/90.9 |
| B’ | 99.5/99.5 | 98.2/96.8 | 97.7/96.8 | 97.7/96.3 | 93.6/91.8 |
| C’ | 99.5/99.5 | 98.2/96.8 | 97.7/96.8 | 97.3/95.9 | 91.3/90.0 |
| D’ | 99.5/100 | 98.6/99.5 | 96.8/98.2 | 94.5/96.3 | 87.2/89.5 |
| E’ | 98.2/98.6 | 96.8/98.2 | 94.5/96.3 | 91.3/94.1 | 83.6/87.2 |
| F’ | 98.2/98.6 | 96.8/98.2 | 95.0/96.4 | 92.2/95.0 | 82.6/85.8 |
Table 4 Foregut species misclassified using amplicon B’ compared with full length sequences
| Species | Weight (of 9484) | Species identified using amplicon B |
| Atopobium AY959044 | 8 | Atopobium parvulum |
| Bacteroides vulgatus | 1 | Uncultured bacterium |
| Bradyrhizobium japonicum | 0 | Blastobacter denitrificans |
| Bradyrhizobium liaoningense | 1 | Blastobacter denitrificans |
| Escherichia fergusonii | 1 | Shigella sonnei |
| Escherichia flexneri | 4 | Shigella sonnei |
| Haemophilus aegyptius | 17 | Haemophilus influenzae |
| Haemophilus haemolyticus | 34 | Haemophilus |
| Lactobacillus gasseri | 2 | Lactobacillus johnsonii |
| Leptotrichia wadeii | 10 | Leptotrichia shahii |
| Neisseria macaca | 28 | Uncultured bacterium |
| Prevotella melaninogenica | 369 | Uncultured bacterium |
| Pseudoramibacter | 3 | Uncultured bacterium |
| Streptococcus infantis | 193 | Streptococcus mitis |
| Total | 671 |
Table 5 Esophageal species misclassified using amplicon B’ compared with Sanger sequences
| Species | Weight (of 6800) | Species identified by Amplicon B’ |
| Actinomyces naeslundii | 2 | Actinomyces viscosus |
| Atopobium AY959044 | 8 | Atopobium parvulum |
| Bacteroides vulgatus | 1 | Uncultured bacterium |
| Bradyrhizobium japonicum | 1 | Blastobacter denitrificans |
| Campylobacter showae | 4 | Campylobacter |
| Escherichia flexneri | 2 | Shigella sonnei |
| Haemophilus aegyptius | 17 | Haemophilus influenzae |
| Haemophilus haemolyticus | 33 | Haemophilus |
| Lactobacillus gasseri | 2 | Lactobacillus johnsonii |
| Leptotrichia wadeii | 7 | Leptotrichia shahii turn |
| Neisseria macaca | 25 | Uncultured bacterium |
| Prevotella melaninogenica | 288 | Uncultured bacterium |
| Pseudoramibacter | 1 | Uncultured bacterium |
| Streptococcus infantis | 77 | Streptococcus mitis |
| Total | 468 |
Table 6 Taxonomic coverage of domain bacteria by primers 347F and 803R
| Primer | Optimization | Total species | Coverage at mismatches n (%) | Total sequence | Coverage at mismatches n (%) | ||||
| 0 | 1 | 2 | 0 | 1 | 2 | ||||
| 374F | Before | 5165 | 3392 (65.7) | 4835 (93.6) | 5042 (97.6) | 433 306 | 275 801 (63.7) | 406 626 (93.8) | 418 613 (96.6) |
| After | 5165 | 4703 (91.1) | 4996 (96.7) | 5114 (99.0) | 433 306 | 391 695 (90.4) | 418 832 (96.7) | 424 756 (98.0) | |
| 803R | Before | 5165 | 4584 (88.8) | 5091 (98.6) | 5159 (99.9) | 433 306 | 352 827 (81.4) | 417 612 (96.4) | 430 967 (99.5) |
| After | 5165 | 4741 (91.8) | 5131 (99.3) | 5159 (99.9) | 433 306 | 367 771 (84.9) | 427 791 (98.7) | 431 725 (99.6) | |
- Citation: Nossa CW, Oberdorf WE, Yang L, Aas JA, Paster BJ, DeSantis TZ, Brodie EL, Malamud D, Poles MA, Pei Z. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome. World J Gastroenterol 2010; 16(33): 4135-4144
- URL: https://www.wjgnet.com/1007-9327/full/v16/i33/4135.htm
- DOI: https://dx.doi.org/10.3748/wjg.v16.i33.4135