©2010 Baishideng.
World J Gastroenterol. Jun 7, 2010; 16(21): 2657-2663
Published online Jun 7, 2010. doi: 10.3748/wjg.v16.i21.2657
Published online Jun 7, 2010. doi: 10.3748/wjg.v16.i21.2657
Table 1 Primer sequences for real-time RT-PCR analyses
| Genes | GenBank | ||
| Number | Forward | Reverse | |
| β-actin | V01217 | TCCTCCTGAGCGCAAGTACTCT | GCTCAGTAACAGTCCGCCTAGAA |
| Nrf2 | NM_057152 | CCATGCCTTCTTCCACGAA | AGGGCCCATGGATTTCAGTT |
| Nqo1 | NM_017000 | CCAATCCTCCACCCACTTGT | GTCCCTCAGCCATTGTTTGAG |
Table 2 Liver index, serum HA, ALT, and SOD, MDA, GST of liver homogenate in different groups (mean ± SD)
| Group | n | Liver index (relative liver weight) | HA (ng/mL) | ALT (U/L) | SOD (μ/mg) | MDA (nmol/mg) | GST (μ/mg) |
| A | 8 | 0.03 ± 0.000 | 351.75 ± 125.16 | 57.25 ± 6.88 | 1.76 ± 0.34 | 0.206 ± 0.052 | 5.95 ± 1.97 |
| B | 8 | 0.054 ± 0.009a | 828.50 ± 237.83a | 203.25 ± 31.62a | 1.08 ± 0.19a | 0.335 ± 0.056a | 7.30 ± 1.26a |
| C | 9 | 0.038 ± 0.008c | 502.33 ± 110.57c | 149.44 ± 16.51ac | 1.36 ± 0.09c | 0.294 ± 0.026ac | 7.37 ± 0.87a |
| D | 8 | 0.036 ± 0.007c | 524.25 ± 255.42c | 136.88 ± 10.07ac | 1.42 ± 0.13c | 0.285 ± 0.025ac | 7.35 ± 0.88a |
| E | 8 | 0.036 ± 0.005c | 499.25 ± 198.10c | 127.38 ± 11.03ac | 1.50 ± 0.15c | 0.284 ± 0.028ac | 7.81 ± 1.16a |
Table 3 Degree of hepatic fibrosis in each group of rats
Table 4 Expression of Nrf2 and Nqo1 in each group (mean ± SD)
| Group | n | Relative amount of mRNA | Protein expression (%) | Protein level | |||
| Nrf2 | Nqo1 | Nrf2 | Nqo1 | Nrf2 | Nqo1 | ||
| A | 8 | 46.86 ± 6.49 | 13.38 ± 4.37 | 57.50 ± 26.14 | 15.25 ± 3.62 | 0.21 ± 0.03 | 0.06 ± 0.03 |
| B | 8 | 254.88 ± 55.96a | 68.38 ± 12.61a | 78.75 ± 15.29a | 42.50 ± 16.26a | 0.30 ± 0.06a | 0.16 ± 0.02a |
| C | 9 | 333.44 ± 90.53a | 72.78 ± 15.94a | 85.11 ± 13.65a | 54.44 ± 15.09a | 0.34 ± 0.08a | 0.18 ± 0.03a |
| D | 8 | 277.00 ± 67.38a | 70.63 ± 20.17a | 80.00 ± 21.38a | 50.63 ± 18.98a | 0.33 ± 0.09a | 0.17 ± 0.04a |
| E | 8 | 345.00 ± 72.60a | 77.88 ± 27.50a | 87.25 ± 14.16a | 58.13 ± 15.80a | 0.35 ± 0.09a | 0.18 ± 0.02a |
-
Citation: Wang YP, Cheng ML, Zhang BF, Mu M, Wu J. Effects of blueberry on hepatic fibrosis and transcription factor
Nrf2 in rats. World J Gastroenterol 2010; 16(21): 2657-2663 - URL: https://www.wjgnet.com/1007-9327/full/v16/i21/2657.htm
- DOI: https://dx.doi.org/10.3748/wjg.v16.i21.2657
