©2010 Baishideng.
World J Gastroenterol. May 14, 2010; 16(18): 2235-2243
Published online May 14, 2010. doi: 10.3748/wjg.v16.i18.2235
Published online May 14, 2010. doi: 10.3748/wjg.v16.i18.2235
Table 1 Primer sequences used for target gene amplification
| GenBank accession No. | Gene | Forward primer | Reverse primer |
| M14745.1 | Bcl-2 | TGGATGACTGAGTACCTGA | TGAGCAGAGTCTTCAGAGA |
| L22473.1 | Bax | AACCATCATGGGCTGGA | CGCCACAAAGATGGTCA |
| AF077350.1 | Survivin | AAGGCTGGGAGCCAGA | TGGCTCTTTCTCTGTCCA |
| BC083511 | GAPDH | TCATCAGCAATGCCTCCTGCA | TGGGTGGCAGTGATGGCA |
Table 2 Concentrations of four caged xanthones and doxorubicin causing a 50% inhibitory effect (IC50) in cell proliferation
| Cells | IC50 values (μmol/L) | ||||
| Isomorellin | Isomorellinol | Forbesione | Gambogic acid | Doxorubicin | |
| KKU-100 | 0.11 ± 0.004 | 2.2 ± 0.33 | 0.15 ± 0.007 | 2.64 ± 1.29 | 0.66 ± 0.001 |
| KKU-M156 | 0.12 ± 0.005 | 0.43 ± 0.06 | 0.02 ± 0.002 | 0.03 ± 0.004 | 0.36 ± 0.001 |
| PBMC | > 88 × 104 | 59 ± 2.9 | 59.5 ± 1.0 | 11 ± 3 | ND |
Table 3 Percentage of apoptotic cells in the four caged xanthone-treated and non treated CCA cell lines
| Compounds | % apoptotic cells | |||
| KKU-100 (h) | KKU-M156 (h) | |||
| 36 | 48 | 24 | 36 | |
| Control | 8 ± 1.45 | 13 ± 0.66 | 8 ± 0.88 | 23 ± 0.66 |
| Isomorellinol | 44 ± 2.31b | 79 ± 1.76b | 34 ± 1.50b | 89 ± 1.20b |
| Forbesione | 34 ± 0.67b | 78 ± 1.15b | 38 ± 3.17b | 83 ± 3.05b |
| Gambogic acid | 32 ± 0.87b | 70 ± 1.45b | 17 ± 1.50a | 72 ± 0.66b |
| Isomorellin | 25 ± 1.21b | 69 ± 1.76b | 31 ± 0.58b | 77 ± 4.16b |
Table 4 Bax/Bcl-2 ratios of the four caged xanthone-treated and non treated CCA cell lines
| Compounds | Bax/Bcl-2 ratio | |||||||
| KKU-100 (h) | KKU-M156 (h) | |||||||
| 0 | 12 | 24 | 48 | 0 | 12 | 24 | 48 | |
| Isomorellinol | 0.98 | 1.58 | 1.98 | 120 | 0.73 | 1.04 | 1.43 | 41.40 |
| Forbesione | 1.02 | 1.93 | 2.35 | 2.91 | 1.53 | 2.38 | 5.12 | 7.02 |
| Gambogic acid | 0.81 | 1.51 | 3.42 | 7.00 | 0.43 | 0.72 | 1.83 | 3.14 |
| Isomorellin | 0.98 | 1.98 | 3.12 | 5.20 | 0.56 | 0.70 | 1.00 | 1.90 |
Table 5 Fold decrease or increase of apoptotic-related proteins of the four caged xanthone-treated compared to non treated CCA cell lines
| Apoptotic proteins | Compounds | Fold change in protein of the treated cells compared to control cells | |||||||
| KKU-100 (h) | KKU-M156 (h) | ||||||||
| 0 | 12 | 24 | 48 | 0 | 12 | 24 | 48 | ||
| Activated caspase-9 | Isomorellinol | 1 | 54 | 56 | 55 | 1 | 1 | 58 | 49 |
| Forbesione | 1 | 9.6 | 13.1 | 13 | 1 | 5.7 | 8 | 5.6 | |
| Gambogic acid | 1 | 30 | 78 | 60 | 1 | 2.6 | 4.5 | 3.9 | |
| Isomorellin | 1 | 6.3 | 12.3 | 9.3 | 1 | 1 | 29 | 34 | |
| Activated caspase-3 | Isomorellinol | 1 | 10.6 | 11 | 11.2 | 1 | 20.2 | 30.4 | 33 |
| Forbesione | 1 | 6 | 9.6 | 12 | 1 | 5.7 | 9.6 | 10 | |
| Gambogic acid | 1 | 5.5 | 7.5 | 12.2 | 1 | 28 | 39.3 | 46.7 | |
| Isomorellin | 1 | 8.9 | 10 | 13 | 1 | 5 | 5.7 | 12 | |
| Survivin | Isomorellinol | 1 | 0.8 | 0.7 | 0.01 | 1 | 0.8 | 0.6 | 0.01 |
| Forbesione | 1 | 0.5 | 0.54 | 0.3 | 1 | 0.7 | 0.54 | 0.5 | |
| Gambogic acid | 1 | 0.6 | 0.4 | 0.3 | 1 | 0.7 | 0.6 | 0.4 | |
| Isomorellin | 1 | 0.6 | 0.5 | 0.3 | 1 | 0.8 | 0.5 | 0.3 | |
| AIF | Isomorellinol | 1 | 1.6 | 1.9 | 2.3 | 1 | 1.6 | 1.9 | 2.2 |
| Forbesione | 1 | 1.2 | 1.6 | 2.1 | 1 | 1.6 | 2.8 | 4 | |
| Gambogic acid | 1 | 1.5 | 1.6 | 2.7 | 1 | 1.6 | 2.1 | 3.4 | |
| Isomorellin | 1 | 1.9 | 3.3 | 3.5 | 1 | 1.3 | 1.7 | 2.5 | |
-
Citation: Hahnvajanawong C, Boonyanugomol W, Nasomyon T, Loilome W, Namwat N, Anantachoke N, Tassaneeyakul W, Sripa B, Namwat W, Reutrakul V. Apoptotic activity of caged xanthones from
Garcinia hanburyi in cholangiocarcinoma cell lines. World J Gastroenterol 2010; 16(18): 2235-2243 - URL: https://www.wjgnet.com/1007-9327/full/v16/i18/2235.htm
- DOI: https://dx.doi.org/10.3748/wjg.v16.i18.2235
