©2009 The WJG Press and Baishideng.
World J Gastroenterol. Feb 14, 2009; 15(6): 705-712
Published online Feb 14, 2009. doi: 10.3748/wjg.15.705
Published online Feb 14, 2009. doi: 10.3748/wjg.15.705
Table 1 List of primer sequences used in RT-PCR
| p300 | XM_576312 | Forward | 5GAGGTCACTGTTCGGGTTGTTC |
| p300 | XM_576312 | Reverse | 5TGGTTCGATATGGAAAAGATTCTG |
| BHMT | NM_030850 | Forward | 5GGGCAGAAGGTCAATGAAGCT |
| BHMT | NM_030850 | Reverse | 5ACCAATGCATCCCCTTCGT |
- Citation: Oliva J, Dedes J, Li J, French SW, Bardag-Gorce F. Epigenetics of proteasome inhibition in the liver of rats fed ethanol chronically. World J Gastroenterol 2009; 15(6): 705-712
- URL: https://www.wjgnet.com/1007-9327/full/v15/i6/705.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.705
