Application of Stool-PCR test for diagnosis of Helicobacter pylori infection in children

Table 1 Primers sequences and PCR conditions

Primers	Sequences	Product size (bp)	PCR conditions
16sRNA	5'GCTAAGAGATCAGCCTATGTCC3'	500	95°C 5 min (1 cycle); 94°C for 1 min, 55°C for 1 min
	5'TGGCAATCAGCGTCAGGTAATG3'		72°C for 2 min (39 cycles); 72°C for 7 min
VacA (s)	5'ATGGAAATACAACAAACACAC3'	s1: 259	95°C 4 min (1 cycle); 95°C for 1 min, 52°C for 1 min
	5'CTGCTTGAATGCGCCAAAC3'	s2: 286	72°C for 1 min (35 cycles); 72°C for 10 min
vacA (m)	5'CAATCTGTCCAATCAAGCGAG34	m1: 570	95°C 4 min (1 cycle); 95°C for 1 min, 52°C for 1 min
	5'GCGTCTAAATAATTCCAAGG3'	m2: 642	72°C for 1 min (35 cycles); 72°C for 10 min
cagA	5'AATACACCAACGCCTCCA3'	400	94°C for 4 min (1 cycle); 94°C for 1 min, 59°C for 1 min
	5'TTGTTGCCGCTTTTGCTCTC3'		72°C for 1 min (35 cycles); 72°C for 10 min

Table 2 Comparison between the results of biopsy-based tests and Stool-PCR

n/Status	Culture	RUT	Histology	Stool-PCR
1/negative	Negative	Nd	Negative	Negativea
2/negative	Negative	Nd	Negative	Negativea
3/negative	Negative	Nd	Negative	Negativea
4/negative	Negative	Negative	Negative	Negativea
5/negative	Negative	Negative	Negative	Negativea
6/positive	Positive	Negative	Negative	Negativeb
7/negative	Negative	Negative	Negative	Negativea
8/positive	Negative	Positive	Positive	Positivec
9/negative	Negative	Positive	Negative	Negativea
10/negative	Negative	Negative	Negative	Negativea
11/positive	Positive	Positive	Negative	Negativeb
12/positive	Positive	Positive	Positive	Positivec
13/positive	Positive	Positive	Negative	Negativeb
14/positive	Negative	Positive	Positive	Positivec
15/positive	Positive	Positive	Positive	Positivec
16/positive	Positive	Positive	Positive	Positivec
17/positive	Positive	Positive	Positive	Positivec
18/positive	Positive	Positive	Positive	Positivec
19/negative	Negative	Negative	Negative	Negativea
20/positive	Negative	Positive	Positive	Positivec
21/negative	Negative	Negative	Negative	Negativea
22/negative	Negative	Negative	Negative	Negativea
23/positive	Positive	Positive	Negative	Negativeb
24/positive	Positive	Positive	Negative	Negativeb
25/positive	Positive	Positive	Negative	Positivec
26/positive	Negative	Positive	Positive	Positivec
27/negative	Negative	Positive	Negative	Positived
28/positive	Negative	Positive	Positive	Negativeb

Nd: Not-determined; a: True negative; b: False negative; c: True positive; d: False positive. Sensitivity: c/c + b = 62.5; Specificity: a/a + d = 92.3%.

Table 3 Comparison of detected genes in DNA from isolates and DNA from stool

	Detected genes in
n/Status	Isolate			Stool
	16sRNA	vacA	cagA	16sRNA	vacA	cagA
1/negative	-	-	-	-	-	-
2/negative	-	-	-	-	-	-
3/negative	-	-	-	-	-	-
4/negative	-	-	-	-	-	-
5/negative	-	-	-	-	-	-
6/positivea	+	+	-	-	-	-
7/negative	-	-	-	-	-	-
8/positiveb,c	-	-	-	-	-	+
9/negativeb	-	-	-	-	-	-
10/negative	-	-	-	-	-	-
11/positivea,b	-	+	+	-	-	-
12/positivea,b,c	-	-	+	-	+	-
13/positivea,b	+	-	-	-	-	-
14/positiveb,c	-	-	-	-	+	-
15/positivea,b,c	-	+	-	-	+	-
16/positivea,b,c	+	+	+	+	+	-
17/positivea,b,c	-	-	+	+	+	-
18/positivea,b,c	-	-	+	+	+	-
19/negative	-	-	-	-	-	-
20/positiveb,c	-	-	-	+	+	-
21/negative	-	-	-	-	-	-
22/negative	-	-	-	-	-	-
23/positivea,b	-	-	+	-	-	-
24/positivea,b	-	-	+	-	-	-
25/positivea,b	-	-	+	-	+	-
26/positiveb,c	-	-	-	-	+	-
27/negativeb	-	-	-	+	-	-
28/positiveb,c	-	-	-	-	-	-

a: Culture positive; b: RUT positive; c: Histology positive.

Table 4 Relationship between endoscopic features of patients, histopathology, score of H pylori and detection of DNA in stool

n/Status	Endoscopic feature	Histopa-thology	Score of H pylori	Stool PCR
1/negative	Non-ulcer	NSPC	0	Negative
2/negative	Non-ulcer	NST	0	Negative
3/negative	Non-ulcer	Mild chronic gastritis	0	Negative
4/negative	Non-ulcer	Follicular gastritis	0	Negative
5/negative	Non-ulcer	Follicular gastritis + activity	0	Negative
6/positive	Non-ulcer	NSPC	0	Negative
7/negative	Non-ulcer	Mild chronic gastritis	0	Negative
8/positive	Non-ulcer	Follicular gastritis	4	Positive
9/negative	Ulcer	NST	0	Negative
10/negative	Non-ulcer	NSPC	0	Negative
11/positive	Non-ulcer	Follicular gastritis	0	Negative
12/positive	Non-ulcer	Follicular gastritis + activity	4	Positive
13/positive	Non-ulcer	Follicular gastritis	0	Negative
14/positive	Non-ulcer	Moderate chronic gastritis	1	Positive
15/positive	Multiple ulcers	Moderate chronic gastritis	4	Positive
16/positive	Non-ulcer	Moderate chronic gastritis	2	Positive
17/positive	Ulcer	Grading was not possible	1	Positive
18/positive	Non-ulcer	Follicular gastritis + activity	5	Positive
19/positive	Non-ulcer	Mild chronic gastritis	0	Negative
20/positive	Non-ulcer	Follicular gastritis	3	Positive
21/negative	Non-ulcer	NSPC	0	Negative
22/negative	Non-ulcer	NSPC	0	Negative
23/positive	Non-ulcer	Moderate chronic gastritis	0	Negative
24/positive	Non-ulcer	Mild chronic gastritis	0	Negative
25/positive	Non-ulcer	Mild chronic gastritis	0	Positive
26/positive	Non-ulcer	Follicular gastritis	2	Positive
27/negative	Multiple ulcers	Mild chronic gastritis	0	Positive
28/positive	Non-ulcer	Moderate chronic gastritis	3	Negative

NSPC: No significant pathologic change; NST: No suitable tissue.