©2009 The WJG Press and Baishideng.
World J Gastroenterol. Jan 28, 2009; 15(4): 484-488
Published online Jan 28, 2009. doi: 10.3748/wjg.15.484
Published online Jan 28, 2009. doi: 10.3748/wjg.15.484
Table 1 Primers sequences and PCR conditions
| Primers | Sequences | Product size (bp) | PCR conditions |
| 16sRNA | 5'GCTAAGAGATCAGCCTATGTCC3' | 500 | 95°C 5 min (1 cycle); 94°C for 1 min, 55°C for 1 min |
| 5'TGGCAATCAGCGTCAGGTAATG3' | 72°C for 2 min (39 cycles); 72°C for 7 min | ||
| VacA (s) | 5'ATGGAAATACAACAAACACAC3' | s1: 259 | 95°C 4 min (1 cycle); 95°C for 1 min, 52°C for 1 min |
| 5'CTGCTTGAATGCGCCAAAC3' | s2: 286 | 72°C for 1 min (35 cycles); 72°C for 10 min | |
| vacA (m) | 5'CAATCTGTCCAATCAAGCGAG34 | m1: 570 | 95°C 4 min (1 cycle); 95°C for 1 min, 52°C for 1 min |
| 5'GCGTCTAAATAATTCCAAGG3' | m2: 642 | 72°C for 1 min (35 cycles); 72°C for 10 min | |
| cagA | 5'AATACACCAACGCCTCCA3' | 400 | 94°C for 4 min (1 cycle); 94°C for 1 min, 59°C for 1 min |
| 5'TTGTTGCCGCTTTTGCTCTC3' | 72°C for 1 min (35 cycles); 72°C for 10 min |
Table 2 Comparison between the results of biopsy-based tests and Stool-PCR
| n/Status | Culture | RUT | Histology | Stool-PCR |
| 1/negative | Negative | Nd | Negative | Negativea |
| 2/negative | Negative | Nd | Negative | Negativea |
| 3/negative | Negative | Nd | Negative | Negativea |
| 4/negative | Negative | Negative | Negative | Negativea |
| 5/negative | Negative | Negative | Negative | Negativea |
| 6/positive | Positive | Negative | Negative | Negativeb |
| 7/negative | Negative | Negative | Negative | Negativea |
| 8/positive | Negative | Positive | Positive | Positivec |
| 9/negative | Negative | Positive | Negative | Negativea |
| 10/negative | Negative | Negative | Negative | Negativea |
| 11/positive | Positive | Positive | Negative | Negativeb |
| 12/positive | Positive | Positive | Positive | Positivec |
| 13/positive | Positive | Positive | Negative | Negativeb |
| 14/positive | Negative | Positive | Positive | Positivec |
| 15/positive | Positive | Positive | Positive | Positivec |
| 16/positive | Positive | Positive | Positive | Positivec |
| 17/positive | Positive | Positive | Positive | Positivec |
| 18/positive | Positive | Positive | Positive | Positivec |
| 19/negative | Negative | Negative | Negative | Negativea |
| 20/positive | Negative | Positive | Positive | Positivec |
| 21/negative | Negative | Negative | Negative | Negativea |
| 22/negative | Negative | Negative | Negative | Negativea |
| 23/positive | Positive | Positive | Negative | Negativeb |
| 24/positive | Positive | Positive | Negative | Negativeb |
| 25/positive | Positive | Positive | Negative | Positivec |
| 26/positive | Negative | Positive | Positive | Positivec |
| 27/negative | Negative | Positive | Negative | Positived |
| 28/positive | Negative | Positive | Positive | Negativeb |
Table 3 Comparison of detected genes in DNA from isolates and DNA from stool
| Detected genes in | ||||||
| n/Status | Isolate | Stool | ||||
| 16sRNA | vacA | cagA | 16sRNA | vacA | cagA | |
| 1/negative | - | - | - | - | - | - |
| 2/negative | - | - | - | - | - | - |
| 3/negative | - | - | - | - | - | - |
| 4/negative | - | - | - | - | - | - |
| 5/negative | - | - | - | - | - | - |
| 6/positivea | + | + | - | - | - | - |
| 7/negative | - | - | - | - | - | - |
| 8/positiveb,c | - | - | - | - | - | + |
| 9/negativeb | - | - | - | - | - | - |
| 10/negative | - | - | - | - | - | - |
| 11/positivea,b | - | + | + | - | - | - |
| 12/positivea,b,c | - | - | + | - | + | - |
| 13/positivea,b | + | - | - | - | - | - |
| 14/positiveb,c | - | - | - | - | + | - |
| 15/positivea,b,c | - | + | - | - | + | - |
| 16/positivea,b,c | + | + | + | + | + | - |
| 17/positivea,b,c | - | - | + | + | + | - |
| 18/positivea,b,c | - | - | + | + | + | - |
| 19/negative | - | - | - | - | - | - |
| 20/positiveb,c | - | - | - | + | + | - |
| 21/negative | - | - | - | - | - | - |
| 22/negative | - | - | - | - | - | - |
| 23/positivea,b | - | - | + | - | - | - |
| 24/positivea,b | - | - | + | - | - | - |
| 25/positivea,b | - | - | + | - | + | - |
| 26/positiveb,c | - | - | - | - | + | - |
| 27/negativeb | - | - | - | + | - | - |
| 28/positiveb,c | - | - | - | - | - | - |
Table 4 Relationship between endoscopic features of patients, histopathology, score of H pylori and detection of DNA in stool
| n/Status | Endoscopic feature | Histopa-thology | Score of H pylori | Stool PCR |
| 1/negative | Non-ulcer | NSPC | 0 | Negative |
| 2/negative | Non-ulcer | NST | 0 | Negative |
| 3/negative | Non-ulcer | Mild chronic gastritis | 0 | Negative |
| 4/negative | Non-ulcer | Follicular gastritis | 0 | Negative |
| 5/negative | Non-ulcer | Follicular gastritis + activity | 0 | Negative |
| 6/positive | Non-ulcer | NSPC | 0 | Negative |
| 7/negative | Non-ulcer | Mild chronic gastritis | 0 | Negative |
| 8/positive | Non-ulcer | Follicular gastritis | 4 | Positive |
| 9/negative | Ulcer | NST | 0 | Negative |
| 10/negative | Non-ulcer | NSPC | 0 | Negative |
| 11/positive | Non-ulcer | Follicular gastritis | 0 | Negative |
| 12/positive | Non-ulcer | Follicular gastritis + activity | 4 | Positive |
| 13/positive | Non-ulcer | Follicular gastritis | 0 | Negative |
| 14/positive | Non-ulcer | Moderate chronic gastritis | 1 | Positive |
| 15/positive | Multiple ulcers | Moderate chronic gastritis | 4 | Positive |
| 16/positive | Non-ulcer | Moderate chronic gastritis | 2 | Positive |
| 17/positive | Ulcer | Grading was not possible | 1 | Positive |
| 18/positive | Non-ulcer | Follicular gastritis + activity | 5 | Positive |
| 19/positive | Non-ulcer | Mild chronic gastritis | 0 | Negative |
| 20/positive | Non-ulcer | Follicular gastritis | 3 | Positive |
| 21/negative | Non-ulcer | NSPC | 0 | Negative |
| 22/negative | Non-ulcer | NSPC | 0 | Negative |
| 23/positive | Non-ulcer | Moderate chronic gastritis | 0 | Negative |
| 24/positive | Non-ulcer | Mild chronic gastritis | 0 | Negative |
| 25/positive | Non-ulcer | Mild chronic gastritis | 0 | Positive |
| 26/positive | Non-ulcer | Follicular gastritis | 2 | Positive |
| 27/negative | Multiple ulcers | Mild chronic gastritis | 0 | Positive |
| 28/positive | Non-ulcer | Moderate chronic gastritis | 3 | Negative |
-
Citation: Falsafi T, Favaedi R, Mahjoub F, Najafi M. Application of Stool-PCR test for diagnosis of
Helicobacter pylori infection in children. World J Gastroenterol 2009; 15(4): 484-488 - URL: https://www.wjgnet.com/1007-9327/full/v15/i4/484.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.484
