Hepatitis B virus subgenotypes and basal core promoter mutations in Indonesia

Table 1 Primers used in this study

Primer	Nucleotide sequence (5’→3’)	Position	Polarity	Reference
Full S
Fgp2	CGCCATGGGAGGTTGGTCTTCCAAACCTCG	2848-2873	Forward	This study
Rgp2	GACAAGCTTAATGTATACCCAAAGACAAAAGAAAATTGG	803-835	Reverse
PreS (nested PCR)
HBPr94	GGTAAAAAGGGACTCACGATG	775-795	Reverse	[2]
HBPr134	TGCTGCTATGCCTCATCTTC	414-433	Forward
HBPr135	CAAAGACAAAAGAAAAATTGC	803-822	Reverse
HBx
Fgp3	CGCCATGGCTGCTAGGCTGTGCTGCCAAC	1374-1398	Forward	This study
Rgp3	CGCTCGAGGGCAGAGGGGAAAAAGTTGCATGGT	1811-1838	Reverse
HBx (nested PCR)
HB1	GCCAAGTGTTTGCTGACGC	1175-1193	Forward	[37]
HB2	CCATACTGCGGAACTCCTAG	1266-1285	Forward
HB3	AAAGTTGCATGGTGCTGGTG	1804-1823	Reverse

Table 2 HBV genotype and serotype distribution in samples with different clinical diagnosis

Characteristics		n(%) in each clinical diagnosis
		CH (n = 61)	LC (n = 62)	HCC			Total (n = 171)	P
				With LC (n = 12)	Without LC (n = 36)	All HCC (n = 48)		CH vs LC	CH vs All HCC	LC vs All HCC	CH vs LC vs All HCC
Genotype and subgenotype
B	B2	5 (8.2)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	5 (2.9)	NS	NS	NA	0.007
	B3	38 (62.3)	41 (66.1)	8 (66.7)	20 (55.6)	28 (58.3)	107 (62.6)	NS	NS	NS	NS
	B4	0 (0.0)	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	1 (0.6)	NS	NA	NS	NS
	B5	0 (0.0)	0 (0.0)	2 (16.7)	3 (8.3)	5 (10.4)	5 (2.9)	NA	0.034	0.032	0.002
	B7	3 (4.9)	2 (3.2)	0 (0.0)	3 (8.3)	3 (6.3)	8 (4.7)	NS	NS	NS	NS
Total genotype B		46 (75.4)	44 (71.0)	10 (83.3)	26 (72.2)	36 (75.0)	126 (73.7)	NS	NS	NS	NS
C	C1	12 (19.7)	13 (21.0)	2 (16.7)	10 (27.8)	12 (25.0)	37 (21.6)	NS	NS	NS	NS
	C2	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (0.6)	NS	NS	NA	NS
	C3	2 (3.3)	5 (8.1)	0 (0.0)	0 (0.0)	0 (0.0)	7 (4.1)	NS	NS	NS	NS
Total genotype C		15 (24.6)	18 (29.0)	2 (16.7)	10 (27.8)	12 (25.0)	45 (26.3)	NS	NS	NS	NS
No. HBV genotype B/C (%-B)		46/15 (75.4)	44/18 (71.0)	10/2 (83.3)	26/10 (72.2)	36/12 (75.0)	126/45 (73.7)	NS	NS	NS	NS
Genotype and serotype
B	adw	0 (0.0)	0 (0.0)	0 (0.0)	1 (2.8)	1 (2.1)	1 (0.6)	NA	NS	NS	NS
	adw2	38 (62.3)	39 (62.9)	9 (75.0)	21 (58.3)	30 (62.5)	107 (62.6)	NS	NS	NS	NS
	adw3	3 (4.9)	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	4 (2.3)	NS	NS	NS	NS
	ayw	0 (0.0)	1 (1.6)	0 (0.0)	1 (2.8)	1 (2.1)	2 (1.2)	NS	NS	NS	NS
	ayw1	5 (8.2)	3 (4.8)	0 (0.0)	4 (11.1)	4 (8.3)	12 (7.0)	NS	NS	NS	NS
C	adrq+	14 (23.0)	17 (27.4)	2 (16.7)	9 (25.0)	11 (22.9)	42 (24.6)	NS	NS	NS	NS
	adw2	0 (0.0)	1 (1.6)	0 (0.0)	1 (2.8)	1 (2.1)	2 (1.2)	NS	NS	NS	NS
	ayr	1 (1.6)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (0.6)	NS	NS	NA	NS

CH: Chronic hepatitis; LC: Liver cirrhosis; HCC: Hepatocellular carcinoma; NS: Not significant; NA: Not applicable; HBV: Hepatitis B virus.

Table 3 Frequencies of some HBx mutations in HBV genotype B according to different clinical diagnosis

Amino acid substitutions	n(%) in each clinical diagnosis
	CH (n = 46)	LC (n = 44)	HCC			Total (n = 126)	P
			With LC (n = 10)	Without LC (n = 26)	All HCC (n = 36)		CH vs LC	CH vs All HCC	LC vs All HCC	CH vs LC vs All HCC
T118N	23 (50.0)	6 (13.6)	4 (40.0)	7 (26.9)	11 (30.6)	40 (31.7)	< 0.001	NS	NS	0.028
I127N/T/S	5 (10.9)	16 (36.4)	2 (20.0)	2 (7.7)	4 (11.1)	25 (19.8)	0.009	NS	0.019	NS
K130M	8 (17.4)	23 (52.3)	5 (50.0)	11 (42.3)	16 (44.4)	47 (37.3)	0.001	0.015	NS	0.006
V131I	8 (17.4)	22 (50.0)	4 (40.0)	11 (42.3)	15 (41.6)	45 (35.7)	0.002	0.030	NS	0.012

Table 4 Prevalence of HBx and core promoter mutations in samples with different clinical diagnosis

Characteristics	n(%) in each clinical diagnosis
	CH (n = 61)	LC (n = 62)	HCC			Total (n = 171)	P
			With LC (n = 12)	Without LC (n = 36)	All HCC (n = 48)		CH vs LC	CH vs All HCC	LC vs All HCC	CH vs LC vs All HCC
Genotype B/C (%B)	46/15 (75.4)	44/18 (71.0)	10/2 (83.3)	26/10 (72.2)	36/12 (75.0)	126/45 (73.7)	NS	NS	NS	NS
BCP mutations
C1726A/T1727(C/T)	24 (39.3)	8 (12.9)	4 (33.3)	7 (19.4)	11 (22.9)	43 (34.1)	0.002	NS	0.015	0.003
T1753V	11 (18.0)	29 (46.8)	2 (16.7)	9 (25.0)	11 (22.9)	51 (40.5)	0.015	NS	0.018	0.004
A1762T	12 (19.7)	38 (61.3)	6 (50.0)	21 (58.3)	27 (56.3)	77 (61.1)	< 0.001	< 0.001	NS	< 0.001
G1764A	13 (21.3)	38 (61.3)	5 (41.7)	21 (58.3)	26 (54.2)	77 (61.1)	< 0.001	0.0002	NS	< 0.001
C1766T	1 (1.6)	3 (4.8)	1 (8.3)	1 (2.8)	2 (4.2)	6 (4.8)	NS	NS	NS	NS
T1768A	1 (1.6)	2 (3.2)	1 (8.3)	2 (5.6)	3 (6.3)	6 (4.8)	NS	NS	NS	NS
A1762T/G1764A	12 (19.7)	37 (59.7)	5 (41.7)	21 (58.3)	26 (54.2)	75 (59.5)	< 0.001	0.0004	NS	< 0.001

Table 5 Single nucleotide polymorphisms in 1726/1727 of HBV Genotype B and C

SNP	n(%) in each HBV genotype and clinical diagnosis
	Genotype B						Genotype C
	CH (n = 46)	LC (n = 44)	HCC			P	CH (n = 15)	LC (n = 18)	HCC			P
			With LC (n = 10)	Without LC (n = 26)	All HCC (n = 36)				With LC (n = 2)	Without LC (n = 10)	All HCC (n = 12)
1726A	24 (52.2)	9 (20.5)	4 (40.0)	8 (30.8)	11 (33.3)	0.009	13 (86.7)	13 (72.2)	2 (100.0)	7 (70.0)	9 (75.0)	NS
1726C	19 (41.3)	35 (79.5)	6 (60.0)	18 (69.2)	24 (66.7)	0.001	2 (13.3)	5 (27.8)	0 (0.0)	3 (30.0)	4 (33.3)	NS
1726T	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NS	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NA
1727A	1 (2.2)	2 (4.5)	0 (0.0)	0 (0.0)	0 (0.0)	NS	8 (53.3)	11 (61.1)	2 (100.0)	2 (20.0)	4 (33.3)	NS
1727C	0 (0.0)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NA
1727G	1 (2.2)	2 (4.5)	0 (0.0)	1 (3.8)	1 (2.8)	NS	4 (26.7)	2 (11.1)	0 (0.0)	5 (50.0)	5 (41.7)	NS
1727T	44 (95.7)	39 (88.6)	10 (100.0)	25 (96.2)	35 (97.2)	NS	3 (20.0)	5 (27.8)	0 (0.0)	3 (30.0)	3 (25.0)	NS
1726A/1727A	1 (2.2)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	7 (46.7)	10 (55.6)	2 (100.0)	2 (20.0)	4 (33.3)	NS
1726A/1727G	1 (2.2)	1 (2.3)	0 (0.0)	1 (3.8)	1 (2.8)	NS	4 (26.7)	2 (11.1)	0 (0.0)	5 (50.0)	5 (41.7)	NS
1726A/1727T	22 (47.8)	7 (15.9)	4 (40.0)	7 (26.9)	11 (30.6)	0.007	2 (13.3)	1 (5.6)	0 (0.0)	0 (0.0)	0 (0.0)	NS
1726C/1727A	0 (0.0)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	1 (6.7)	1 (5.6)	0 (0.0)	0 (0.0)	0 (0.0)	NS
1726C/1727G	0 (0.0)	1 (2.3)	0 (0.0)	0 (0.0)	0 (0.0)	NS	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	NA
1726C/1727T	19 (41.3)	32 (72.7)	6 (60.0)	18 (69.2)	24 (66.7)	0.006	1 (6.7)	4 (22.2)	0 (0.0)	3 (30.0)	3 (25.0)	NS

Table 6 Comparison of core promoter mutations in HBV genotype B and C

Characteristics	HBV genotype			P
	B	C	All
No. (%) of patients	126 (73.7)	45 (26.3)	171 (100.0)	< 0.001
Age (mean ± SD)	44.3 ± 12.8	49.4 ± 13.3	45.6 ± 13.1	0.024
Male/Female (%Male)	95/31 (75.4)	32/13 (71.1)	127/44 (74.3)	NS
No. (%) of A1762T/G1764A	42 (33.3)	33 (73.3)	75 (43.9)	< 0.001
No. (%) of T1753V	26 (20.6)	25 (55.6)	51 (29.8)	< 0.001
No. (%) of C1726A/T1727 (C/T)	40 (31.7)	3 (6.7)	43 (25.1)	0.002