BPG is committed to discovery and dissemination of knowledge
Brief Article
©2009 The WJG Press and Baishideng.
World J Gastroenterol. Aug 28, 2009; 15(32): 4028-4036
Published online Aug 28, 2009. doi: 10.3748/wjg.15.4028
Table 1 Primers used in this study
PrimerNucleotide sequence (5’→3’)PositionPolarityReference
Full S
Fgp2CGCCATGGGAGGTTGGTCTTCCAAACCTCG2848-2873ForwardThis study
Rgp2GACAAGCTTAATGTATACCCAAAGACAAAAGAAAATTGG803-835Reverse
PreS (nested PCR)
HBPr94GGTAAAAAGGGACTCACGATG775-795Reverse[2]
HBPr134TGCTGCTATGCCTCATCTTC414-433Forward
HBPr135CAAAGACAAAAGAAAAATTGC803-822Reverse
HBx
Fgp3CGCCATGGCTGCTAGGCTGTGCTGCCAAC1374-1398ForwardThis study
Rgp3CGCTCGAGGGCAGAGGGGAAAAAGTTGCATGGT1811-1838Reverse
HBx (nested PCR)
HB1GCCAAGTGTTTGCTGACGC1175-1193Forward[37]
HB2CCATACTGCGGAACTCCTAG1266-1285Forward
HB3AAAGTTGCATGGTGCTGGTG1804-1823Reverse
Table 2 HBV genotype and serotype distribution in samples with different clinical diagnosis
Characteristicsn(%) in each clinical diagnosis
CH (n = 61)LC (n = 62)HCC
Total (n = 171)P
With LC (n = 12)Without LC (n = 36)All HCC (n = 48)CH vs LCCH vs All HCCLC vs All HCCCH vs LC vs All HCC
Genotype and subgenotype
BB25 (8.2)0 (0.0)0 (0.0)0 (0.0)0 (0.0)5 (2.9)NSNSNA0.007
B338 (62.3)41 (66.1)8 (66.7)20 (55.6)28 (58.3)107 (62.6)NSNSNSNS
B40 (0.0)1 (1.6)0 (0.0)0 (0.0)0 (0.0)1 (0.6)NSNANSNS
B50 (0.0)0 (0.0)2 (16.7)3 (8.3)5 (10.4)5 (2.9)NA0.0340.0320.002
B73 (4.9)2 (3.2)0 (0.0)3 (8.3)3 (6.3)8 (4.7)NSNSNSNS
Total genotype B46 (75.4)44 (71.0)10 (83.3)26 (72.2)36 (75.0)126 (73.7)NSNSNSNS
CC112 (19.7)13 (21.0)2 (16.7)10 (27.8)12 (25.0)37 (21.6)NSNSNSNS
C21 (1.6)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (0.6)NSNSNANS
C32 (3.3)5 (8.1)0 (0.0)0 (0.0)0 (0.0)7 (4.1)NSNSNSNS
Total genotype C15 (24.6)18 (29.0)2 (16.7)10 (27.8)12 (25.0)45 (26.3)NSNSNSNS
No. HBV genotype B/C (%-B)46/15 (75.4)44/18 (71.0)10/2 (83.3)26/10 (72.2)36/12 (75.0)126/45 (73.7)NSNSNSNS
Genotype and serotype
Badw0 (0.0)0 (0.0)0 (0.0)1 (2.8)1 (2.1)1 (0.6)NANSNSNS
adw238 (62.3)39 (62.9)9 (75.0)21 (58.3)30 (62.5)107 (62.6)NSNSNSNS
adw33 (4.9)1 (1.6)0 (0.0)0 (0.0)0 (0.0)4 (2.3)NSNSNSNS
ayw0 (0.0)1 (1.6)0 (0.0)1 (2.8)1 (2.1)2 (1.2)NSNSNSNS
ayw15 (8.2)3 (4.8)0 (0.0)4 (11.1)4 (8.3)12 (7.0)NSNSNSNS
Cadrq+14 (23.0)17 (27.4)2 (16.7)9 (25.0)11 (22.9)42 (24.6)NSNSNSNS
adw20 (0.0)1 (1.6)0 (0.0)1 (2.8)1 (2.1)2 (1.2)NSNSNSNS
ayr1 (1.6)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (0.6)NSNSNANS
Table 3 Frequencies of some HBx mutations in HBV genotype B according to different clinical diagnosis
Amino acid substitutionsn(%) in each clinical diagnosis
CH (n = 46)LC (n = 44)HCC
Total (n = 126)P
With LC (n = 10)Without LC (n = 26)All HCC (n = 36)CH vs LCCH vs All HCCLC vs All HCCCH vs LC vs All HCC
T118N23 (50.0)6 (13.6)4 (40.0)7 (26.9)11 (30.6)40 (31.7)< 0.001NSNS0.028
I127N/T/S5 (10.9)16 (36.4)2 (20.0)2 (7.7)4 (11.1)25 (19.8)0.009NS0.019NS
K130M8 (17.4)23 (52.3)5 (50.0)11 (42.3)16 (44.4)47 (37.3)0.0010.015NS0.006
V131I8 (17.4)22 (50.0)4 (40.0)11 (42.3)15 (41.6)45 (35.7)0.0020.030NS0.012
Table 4 Prevalence of HBx and core promoter mutations in samples with different clinical diagnosis
Characteristicsn(%) in each clinical diagnosis
CH (n = 61)LC (n = 62)HCC
Total (n = 171)P
With LC (n = 12)Without LC (n = 36)All HCC (n = 48)CH vs LCCH vs All HCCLC vs All HCCCH vs LC vs All HCC
Genotype B/C (%B)46/15 (75.4)44/18 (71.0)10/2 (83.3)26/10 (72.2)36/12 (75.0)126/45 (73.7)NSNSNSNS
BCP mutations
C1726A/T1727(C/T)24 (39.3)8 (12.9)4 (33.3)7 (19.4)11 (22.9)43 (34.1)0.002NS0.0150.003
T1753V11 (18.0)29 (46.8)2 (16.7)9 (25.0)11 (22.9)51 (40.5)0.015NS0.0180.004
A1762T12 (19.7)38 (61.3)6 (50.0)21 (58.3)27 (56.3)77 (61.1)< 0.001< 0.001NS< 0.001
G1764A13 (21.3)38 (61.3)5 (41.7)21 (58.3)26 (54.2)77 (61.1)< 0.0010.0002NS< 0.001
C1766T1 (1.6)3 (4.8)1 (8.3)1 (2.8)2 (4.2)6 (4.8)NSNSNSNS
T1768A1 (1.6)2 (3.2)1 (8.3)2 (5.6)3 (6.3)6 (4.8)NSNSNSNS
A1762T/G1764A12 (19.7)37 (59.7)5 (41.7)21 (58.3)26 (54.2)75 (59.5)< 0.0010.0004NS< 0.001
Table 5 Single nucleotide polymorphisms in 1726/1727 of HBV Genotype B and C
SNPn(%) in each HBV genotype and clinical diagnosis
Genotype B
Genotype C
CH (n = 46)LC (n = 44)HCC
PCH (n = 15)LC (n = 18)HCC
P
With LC (n = 10)Without LC (n = 26)All HCC (n = 36)With LC (n = 2)Without LC (n = 10)All HCC (n = 12)
1726A24 (52.2)9 (20.5)4 (40.0)8 (30.8)11 (33.3)0.00913 (86.7)13 (72.2)2 (100.0)7 (70.0)9 (75.0)NS
1726C19 (41.3)35 (79.5)6 (60.0)18 (69.2)24 (66.7)0.0012 (13.3)5 (27.8)0 (0.0)3 (30.0)4 (33.3)NS
1726T0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)NS0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)NA
1727A1 (2.2)2 (4.5)0 (0.0)0 (0.0)0 (0.0)NS8 (53.3)11 (61.1)2 (100.0)2 (20.0)4 (33.3)NS
1727C0 (0.0)1 (2.3)0 (0.0)0 (0.0)0 (0.0)NS0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)NA
1727G1 (2.2)2 (4.5)0 (0.0)1 (3.8)1 (2.8)NS4 (26.7)2 (11.1)0 (0.0)5 (50.0)5 (41.7)NS
1727T44 (95.7)39 (88.6)10 (100.0)25 (96.2)35 (97.2)NS3 (20.0)5 (27.8)0 (0.0)3 (30.0)3 (25.0)NS
1726A/1727A1 (2.2)1 (2.3)0 (0.0)0 (0.0)0 (0.0)NS7 (46.7)10 (55.6)2 (100.0)2 (20.0)4 (33.3)NS
1726A/1727G1 (2.2)1 (2.3)0 (0.0)1 (3.8)1 (2.8)NS4 (26.7)2 (11.1)0 (0.0)5 (50.0)5 (41.7)NS
1726A/1727T22 (47.8)7 (15.9)4 (40.0)7 (26.9)11 (30.6)0.0072 (13.3)1 (5.6)0 (0.0)0 (0.0)0 (0.0)NS
1726C/1727A0 (0.0)1 (2.3)0 (0.0)0 (0.0)0 (0.0)NS1 (6.7)1 (5.6)0 (0.0)0 (0.0)0 (0.0)NS
1726C/1727G0 (0.0)1 (2.3)0 (0.0)0 (0.0)0 (0.0)NS0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)NA
1726C/1727T19 (41.3)32 (72.7)6 (60.0)18 (69.2)24 (66.7)0.0061 (6.7)4 (22.2)0 (0.0)3 (30.0)3 (25.0)NS
Table 6 Comparison of core promoter mutations in HBV genotype B and C
CharacteristicsHBV genotype
P
BCAll
No. (%) of patients126 (73.7)45 (26.3)171 (100.0)< 0.001
Age (mean ± SD)44.3 ± 12.849.4 ± 13.345.6 ± 13.10.024
Male/Female (%Male)95/31 (75.4)32/13 (71.1)127/44 (74.3)NS
No. (%) of A1762T/G1764A42 (33.3)33 (73.3)75 (43.9)< 0.001
No. (%) of T1753V26 (20.6)25 (55.6)51 (29.8)< 0.001
No. (%) of C1726A/T1727 (C/T)40 (31.7)3 (6.7)43 (25.1)0.002


Write to the Help Desk