Potential therapeutic significance of increased expression of aryl hydrocarbon receptor in human gastric cancer

Table 1 Clinical and histological characteristics of the study population

Histology type	Patient number	Gender		Age (yr) mean ± SD
		Male	Female
CSG	30	20	10	50.47 ± 11.63
CAG	30	12	18	53.27 ± 16.36
IM	30	16	14	52.38 ± 10.26
AH	30	15	15	55.67 ± 16.88
GC	70	37	33	56.59 ± 13.24
i-GC	32	17	15	57.27 ± 14.56
d-GC	38	20	18	55.91 ± 11.62

CSG: Chronic superficial gastritis; CAG: Chronic atrophic gastritis; IM: Intestinal metaplasia; AH: Atypical hyperplasia; GC: Gastric cancer; i-GC: Intestinal-type gastric cancer; d-GC: Diffused-type gastric cancer.

Table 2 Primer sequences and PCR amplification conditions

Gene	Primers (5’→3’)	Annealing temperature (°C)	Cycles	Product size (bp)
AhR	S: ACTCCACTTCAGCCACCATC	55	25	204
	A: ATGGGACTCGGCACAATAAA
CYP1A1	S: CCATGTCGGCCAC-GGAGTT	59	32	174
	A: ACAGTGCCAGGTGCGGGTT
β-actin	S: CTCGCTGTCCACCTTCCA	52	30	256
	A: GCTGTCACCTTCACCGTTC

S: Sense primer; A: Antisense primer.

Table 3 Expression of AhR in gastric cancer and pre-malignant tissues

Histology type	Patient number	AhR expression				AhR positive rate (%)
		-	+	++	+++
CSG	30	16	1	13	0	46.67
CAG	30	8	7	15	0	73.33
IM	30	7	8	15	0	76.67
AH	30	5	5	18	2	83.33
GC	70	2	7	35	26	97.141
i-GC	32	1	3	16	12	96.88
d-GC	38	1	4	19	14	97.37

¹Compared with CSG, CAG, IM and AH, P < 0.05.

Table 4 Nuclear translocation of AhR in gastric cancer and pre-malignant tissues

Histology type	Patient number	Nuclear expression of AhR				AhR nuclear positive rate (%)
		-	+	++	+++
CSG	30	20	1	9	0	33.33
CAG	30	14	5	11	0	53.33
IM	30	13	6	11	0	56.67
AH	30	5	5	18	2	83.332
GC	70	4	6	34	26	94.291
i-GC	32	2	3	15	12	93.75
d-GC	38	2	3	19	14	94.74

¹Compared with CSG, CAG, IM and AH, P < 0.05.

²Compared with CSG, CAG and IM, P < 0.05.

Table 5 The effect of TCDD on AGS cell cycle

TCDD concentration (nmol/L)	Percentage of cell cycle (%)
	G0/G1	S	G2/M
Control	54.47 ± 0.45	39.10 ± 1.39	6.43 ± 1.48
0.01	60.47 ± 3.11a	33.20 ± 2.51	6.33 ± 1.12
0.1	66.07 ± 0.80b	28.67 ± 3.08b	5.33 ± 2.34
1	67.53 ± 2.57b	25.73 ± 4.56b	6.73 ± 2.06
10	67.20 ± 4.33b	25.03 ± 5.31b	7.77 ± 1.99
100	68.57 ± 5.57b	25.10 ± 7.41b	6.33 ± 1.96

Values given are the mean ± SD of three independent experiments.

^aP < 0.05,

^bP < 0.01, compared with respective control value.

Table 6 The effect of TCDD on AGS cell apoptosis

TCDD concentration (nmol/L)	Sub-G1	P
Control	8.33 ± 1.59
0.01	9.10 ± 2.46	0.583
0.1	8.20 ± 1.65	0.924
1	7.97 ± 0.31	0.792
10	6.30 ± 1.71	0.161
100	9.57 ± 1.52	0.382

Values of Sub-G₁ given are the mean ± SD of three independent experiments.