©2009 The WJG Press and Baishideng.
World J Gastroenterol. Apr 14, 2009; 15(14): 1719-1729
Published online Apr 14, 2009. doi: 10.3748/wjg.15.1719
Published online Apr 14, 2009. doi: 10.3748/wjg.15.1719
Table 1 Clinical and histological characteristics of the study population
| Histology type | Patient number | Gender | Age (yr) mean ± SD | |
| Male | Female | |||
| CSG | 30 | 20 | 10 | 50.47 ± 11.63 |
| CAG | 30 | 12 | 18 | 53.27 ± 16.36 |
| IM | 30 | 16 | 14 | 52.38 ± 10.26 |
| AH | 30 | 15 | 15 | 55.67 ± 16.88 |
| GC | 70 | 37 | 33 | 56.59 ± 13.24 |
| i-GC | 32 | 17 | 15 | 57.27 ± 14.56 |
| d-GC | 38 | 20 | 18 | 55.91 ± 11.62 |
Table 2 Primer sequences and PCR amplification conditions
| Gene | Primers (5’→3’) | Annealing temperature (°C) | Cycles | Product size (bp) |
| AhR | S: ACTCCACTTCAGCCACCATC | 55 | 25 | 204 |
| A: ATGGGACTCGGCACAATAAA | ||||
| CYP1A1 | S: CCATGTCGGCCAC-GGAGTT | 59 | 32 | 174 |
| A: ACAGTGCCAGGTGCGGGTT | ||||
| β-actin | S: CTCGCTGTCCACCTTCCA | 52 | 30 | 256 |
| A: GCTGTCACCTTCACCGTTC |
Table 3 Expression of AhR in gastric cancer and pre-malignant tissues
| Histology type | Patient number | AhR expression | AhR positive rate (%) | |||
| - | + | ++ | +++ | |||
| CSG | 30 | 16 | 1 | 13 | 0 | 46.67 |
| CAG | 30 | 8 | 7 | 15 | 0 | 73.33 |
| IM | 30 | 7 | 8 | 15 | 0 | 76.67 |
| AH | 30 | 5 | 5 | 18 | 2 | 83.33 |
| GC | 70 | 2 | 7 | 35 | 26 | 97.141 |
| i-GC | 32 | 1 | 3 | 16 | 12 | 96.88 |
| d-GC | 38 | 1 | 4 | 19 | 14 | 97.37 |
Table 4 Nuclear translocation of AhR in gastric cancer and pre-malignant tissues
Table 5 The effect of TCDD on AGS cell cycle
| TCDD concentration (nmol/L) | Percentage of cell cycle (%) | ||
| G0/G1 | S | G2/M | |
| Control | 54.47 ± 0.45 | 39.10 ± 1.39 | 6.43 ± 1.48 |
| 0.01 | 60.47 ± 3.11a | 33.20 ± 2.51 | 6.33 ± 1.12 |
| 0.1 | 66.07 ± 0.80b | 28.67 ± 3.08b | 5.33 ± 2.34 |
| 1 | 67.53 ± 2.57b | 25.73 ± 4.56b | 6.73 ± 2.06 |
| 10 | 67.20 ± 4.33b | 25.03 ± 5.31b | 7.77 ± 1.99 |
| 100 | 68.57 ± 5.57b | 25.10 ± 7.41b | 6.33 ± 1.96 |
Table 6 The effect of TCDD on AGS cell apoptosis
| TCDD concentration (nmol/L) | Sub-G1 | P |
| Control | 8.33 ± 1.59 | |
| 0.01 | 9.10 ± 2.46 | 0.583 |
| 0.1 | 8.20 ± 1.65 | 0.924 |
| 1 | 7.97 ± 0.31 | 0.792 |
| 10 | 6.30 ± 1.71 | 0.161 |
| 100 | 9.57 ± 1.52 | 0.382 |
- Citation: Peng TL, Chen J, Mao W, Liu X, Tao Y, Chen LZ, Chen MH. Potential therapeutic significance of increased expression of aryl hydrocarbon receptor in human gastric cancer. World J Gastroenterol 2009; 15(14): 1719-1729
- URL: https://www.wjgnet.com/1007-9327/full/v15/i14/1719.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.1719
