BPG is committed to discovery and dissemination of knowledge
Original Article
©2009 The WJG Press and Baishideng.
World J Gastroenterol. Apr 14, 2009; 15(14): 1708-1718
Published online Apr 14, 2009. doi: 10.3748/wjg.15.1708
Table 1 PCR primers
GeneGenBank accession sizeOrientationPrimer sequenceAmplicon size
KCRD88577ForwardAAATGACCTCAGCTCCCAGA103
ReverseTTCACCAGCCCTTTCCATAC
CSF-1 receptor (CD115)X06368ForwardTGGCCTTCCTTGCTTCTAAA114
ReverseATGTCCCTAGCCAGTCCAA
HMGCS1NM_145942ForwardGCGGCTAGAAGTTGGAACAG196
ReverseAGCATATCGTCCATCCCAAG
Lipocalin 2NM_008491ForwardCCAGTTCGCCATGGTATTTT169
ReverseGGTGGGGACAGAGAAGATGA
HckBC010478ForwardGCCTCAAAAACAGAGCCAAG150
ReverseGTACAGTGCGACCACAATGG
18S rRNAXR_000144ForwardAATGGTGCTACCGGTCATTCC192
ReverseACCTCTCTTACCCGCTCTC
Table 2 Significantly up- or down-regulated genes ontology
NumberPercentage (%)
Cytoplasm10516.7
Cell growth and/or maintenance8713.8
Integral to membrane8513.5
Nucleus579.0
Nucleoside and nucleic acid metabolism548.6
Protein metabolism548.6
Biosynthesis345.4
Purine nucleotide binding335.2
DNA binding304.8
Signal transduction264.1
Response to external stimulus243.8
Transferase activity, transferring phosphorus containing groups243.8
Lipid metabolism233.7
Plasma membrane193.0
Catabolism182.9
Immune response182.9
Phosphorus metabolism182.9
Peptidase activity162.5
Table 3 Standardized Pubmed search with terms relevant to Kupffer cells abrogating liver injury during cholestasis: Each gene up- or down-regulated > 5-fold
GeneFold changeSearch terms
Articles of interest
*Gene*Kupffer cellsCholestasisApoptosisCell deathSurvivalInflammationLiverLiver repair
Acetyl-coenzyme A synthetase 29.61179---12-19-2
Hydroxysteroid (17-β) dehydrogenase 28.26668--4210370-1
RIKEN cDNA 1110025G127.61----------
HM GCS15.81181--662-67-3
RBP 45.761044221010254219523
RIKEN cDNA 1200011D03 gene5.75----------
Inter-alpha trypsin inhibitor, heavy chain 25.461132-1-31963-5
Lipocalin 25.35375-12425154817115
Hck-5.674--------3
Hypothetical protein 5930431H10-6.15----------
Leucine-rich repeat-containing 5-6.2622--11--1-2
SAM domain and HD domain, 1 (SAMHD1)-6.815---------
Myristoylated alanine rich protein kinase C substrate-7.14458--5710511-3
Heterogeneous nuclear ribonucleoprotein A/B-7.9450--222-5-3
(SCAN-KRAB-) zinc finger gene 1-9.056--1-1---1
Inactive X specific transcripts-12.213---------
Table 4 Overview of function, source and involvement of the 10 genes identified by Pubmed-search: Degree of up- or down-regulation
GeneFold changeBiological functionPrimary cell sourceInvolvementReference
Acetyl-Coenzyme A synthetase 29.61Mitochondrial matrix enzyme involved in CoA ligationMitochondrial matrixActivation during fasting[5051]
HM GCS15.81Cholesterol biosynthesisInhibition induces apoptosis, up-regulation involved in liver regeneration[2526]
RBP45.76An a2-globulin that transports vitamin A from the liverParenchymal liver cells, little in Kupffer cellsKnown marker for hepatocellular necrosis[2223]
Inter-alpha trypsin inhibitor, heavy chain 25.46Plasma protease inhibitorKupffer cellsEndothelial growth factor[2729]
Lipocalin 25.35Iron-siderophore-binding proteinMacrophages, neutrophilsSuppression of inflammation, tissue involution, apoptosis, differentiation of myeloid cells[3140]
Hck-5.67Protein-tyrosine kinaseGranulocytes, monocytesMitogenesis, differentiation, survival, migration[4144]
Leucine-rich repeat-containing 5-6.26Interaction with cellular G-proteinsEnzyme inhibition, cell adhesion, cellular trafficking, proliferation and activation of lymphocytes and monocytes[4552]
Myristoylated alanine rich protein kinase C substrate-7.14Substrate of protein kinase CIntracellular signaling, brain development, cellular migration and adhesion, phagocyte activation, phagocytosis[46475355]
Heterogeneous nuclear ribonucleoprotein A/B-7.94Chromatin-associated RNA-binding proteinUbiquitiousRNA handling, proliferation arrest[5657]
(SCAN-KRAB-) zinc finger gene 1-9.05Protein interaction domainUbiquitiousCell survival, differentiation[4849]


Write to the Help Desk