©2009 The WJG Press and Baishideng.
World J Gastroenterol. Apr 14, 2009; 15(14): 1708-1718
Published online Apr 14, 2009. doi: 10.3748/wjg.15.1708
Published online Apr 14, 2009. doi: 10.3748/wjg.15.1708
Table 1 PCR primers
| Gene | GenBank accession size | Orientation | Primer sequence | Amplicon size |
| KCR | D88577 | Forward | AAATGACCTCAGCTCCCAGA | 103 |
| Reverse | TTCACCAGCCCTTTCCATAC | |||
| CSF-1 receptor (CD115) | X06368 | Forward | TGGCCTTCCTTGCTTCTAAA | 114 |
| Reverse | ATGTCCCTAGCCAGTCCAA | |||
| HMGCS1 | NM_145942 | Forward | GCGGCTAGAAGTTGGAACAG | 196 |
| Reverse | AGCATATCGTCCATCCCAAG | |||
| Lipocalin 2 | NM_008491 | Forward | CCAGTTCGCCATGGTATTTT | 169 |
| Reverse | GGTGGGGACAGAGAAGATGA | |||
| Hck | BC010478 | Forward | GCCTCAAAAACAGAGCCAAG | 150 |
| Reverse | GTACAGTGCGACCACAATGG | |||
| 18S rRNA | XR_000144 | Forward | AATGGTGCTACCGGTCATTCC | 192 |
| Reverse | ACCTCTCTTACCCGCTCTC |
Table 2 Significantly up- or down-regulated genes ontology
| Number | Percentage (%) | |
| Cytoplasm | 105 | 16.7 |
| Cell growth and/or maintenance | 87 | 13.8 |
| Integral to membrane | 85 | 13.5 |
| Nucleus | 57 | 9.0 |
| Nucleoside and nucleic acid metabolism | 54 | 8.6 |
| Protein metabolism | 54 | 8.6 |
| Biosynthesis | 34 | 5.4 |
| Purine nucleotide binding | 33 | 5.2 |
| DNA binding | 30 | 4.8 |
| Signal transduction | 26 | 4.1 |
| Response to external stimulus | 24 | 3.8 |
| Transferase activity, transferring phosphorus containing groups | 24 | 3.8 |
| Lipid metabolism | 23 | 3.7 |
| Plasma membrane | 19 | 3.0 |
| Catabolism | 18 | 2.9 |
| Immune response | 18 | 2.9 |
| Phosphorus metabolism | 18 | 2.9 |
| Peptidase activity | 16 | 2.5 |
Table 3 Standardized Pubmed search with terms relevant to Kupffer cells abrogating liver injury during cholestasis: Each gene up- or down-regulated > 5-fold
| Gene | Fold change | Search terms | Articles of interest | ||||||||
| *Gene* | Kupffer cells | Cholestasis | Apoptosis | Cell death | Survival | Inflammation | Liver | Liver repair | |||
| Acetyl-coenzyme A synthetase 2 | 9.61 | 179 | - | - | - | 1 | 2 | - | 19 | - | 2 |
| Hydroxysteroid (17-β) dehydrogenase 2 | 8.26 | 668 | - | - | 4 | 2 | 10 | 3 | 70 | - | 1 |
| RIKEN cDNA 1110025G12 | 7.61 | - | - | - | - | - | - | - | - | - | - |
| HM GCS1 | 5.81 | 181 | - | - | 6 | 6 | 2 | - | 67 | - | 3 |
| RBP 4 | 5.76 | 1044 | 2 | 2 | 10 | 10 | 25 | 42 | 195 | 2 | 3 |
| RIKEN cDNA 1200011D03 gene | 5.75 | - | - | - | - | - | - | - | - | - | - |
| Inter-alpha trypsin inhibitor, heavy chain 2 | 5.46 | 113 | 2 | - | 1 | - | 3 | 19 | 63 | - | 5 |
| Lipocalin 2 | 5.35 | 375 | - | 1 | 24 | 25 | 15 | 48 | 17 | 1 | 15 |
| Hck | -5.67 | 4 | - | - | - | - | - | - | - | - | 3 |
| Hypothetical protein 5930431H10 | -6.15 | - | - | - | - | - | - | - | - | - | - |
| Leucine-rich repeat-containing 5 | -6.26 | 22 | - | - | 1 | 1 | - | - | 1 | - | 2 |
| SAM domain and HD domain, 1 (SAMHD1) | -6.81 | 5 | - | - | - | - | - | - | - | - | - |
| Myristoylated alanine rich protein kinase C substrate | -7.14 | 458 | - | - | 5 | 7 | 10 | 5 | 11 | - | 3 |
| Heterogeneous nuclear ribonucleoprotein A/B | -7.94 | 50 | - | - | 2 | 2 | 2 | - | 5 | - | 3 |
| (SCAN-KRAB-) zinc finger gene 1 | -9.05 | 6 | - | - | 1 | - | 1 | - | - | - | 1 |
| Inactive X specific transcripts | -12.21 | 3 | - | - | - | - | - | - | - | - | - |
Table 4 Overview of function, source and involvement of the 10 genes identified by Pubmed-search: Degree of up- or down-regulation
| Gene | Fold change | Biological function | Primary cell source | Involvement | Reference |
| Acetyl-Coenzyme A synthetase 2 | 9.61 | Mitochondrial matrix enzyme involved in CoA ligation | Mitochondrial matrix | Activation during fasting | [5051] |
| HM GCS1 | 5.81 | Cholesterol biosynthesis | Inhibition induces apoptosis, up-regulation involved in liver regeneration | [2526] | |
| RBP4 | 5.76 | An a2-globulin that transports vitamin A from the liver | Parenchymal liver cells, little in Kupffer cells | Known marker for hepatocellular necrosis | [2223] |
| Inter-alpha trypsin inhibitor, heavy chain 2 | 5.46 | Plasma protease inhibitor | Kupffer cells | Endothelial growth factor | [27–29] |
| Lipocalin 2 | 5.35 | Iron-siderophore-binding protein | Macrophages, neutrophils | Suppression of inflammation, tissue involution, apoptosis, differentiation of myeloid cells | [31–40] |
| Hck | -5.67 | Protein-tyrosine kinase | Granulocytes, monocytes | Mitogenesis, differentiation, survival, migration | [41–44] |
| Leucine-rich repeat-containing 5 | -6.26 | Interaction with cellular G-proteins | Enzyme inhibition, cell adhesion, cellular trafficking, proliferation and activation of lymphocytes and monocytes | [4552] | |
| Myristoylated alanine rich protein kinase C substrate | -7.14 | Substrate of protein kinase C | Intracellular signaling, brain development, cellular migration and adhesion, phagocyte activation, phagocytosis | [464753–55] | |
| Heterogeneous nuclear ribonucleoprotein A/B | -7.94 | Chromatin-associated RNA-binding protein | Ubiquitious | RNA handling, proliferation arrest | [5657] |
| (SCAN-KRAB-) zinc finger gene 1 | -9.05 | Protein interaction domain | Ubiquitious | Cell survival, differentiation | [4849] |
- Citation: Gehring S, Sabo E, Martin MES, Dickson EM, Cheng CW, Gregory SH. Laser capture microdissection and genetic analysis of carbon-labeled Kupffer cells. World J Gastroenterol 2009; 15(14): 1708-1718
- URL: https://www.wjgnet.com/1007-9327/full/v15/i14/1708.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.1708