BPG is committed to discovery and dissemination of knowledge
Basic Research
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Feb 21, 2008; 14(7): 1067-1076
Published online Feb 21, 2008. doi: 10.3748/wjg.14.1067
Table 1 The LAB tested for their anti-inflammatory properties
Lactic acid bacteria (LAB)OriginRemark
Bifidobacterium adolescentis ATCC15703Infant intestine-
B. brevi ATCC15700Infant intestine-
B. dentium scardori & crociani ATCC27534Dental carries-
B. longum ATCC15707Adult intestine-
Enterococcus faecalis EC1Infant fecesIdentified by phenotypic characterization and sequence analysis of 16S rDNA
Age: 1 mo
Enterococcus faecalis EC3Infant fecesIdentified by phenotypic characterization and sequence analysis of 16S rDNA
Age: 3 d
Enterococcus faecalis EC15Infant fecesIdentified by phenotypic characterization and sequence analysis of 16S rDNA
Age: 3 d
Enterococcus faecalis EC16Infant fecesIdentified by phenotypic characterization and sequence analysis of 16S rDNA
Age: 3 d
Other 23 strains of enterococci and lactobacilliInfant fecesIdentified by phenotypic characterization and sequence analysis of 16S rDNA
Age: 3 d to 1 mo
Lactobacillus acidophilus ATCC4356Human-
L. brevis K7Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. brevis T1Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. brevis T6Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. casei ATCC11578Oral-
L. casei IS7257Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. casei subsp. casei NCIMB11970Cheese-
L. casei ShirotaHumanCommercial probiotic
L. delbrueckii subsp. bulgaricus NCIMB11778Bulgarian yogurtCommercial probiotic
L. delbrueckii bulgaricus D1Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. lactis subsp. lactis B4Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. lactis subsp. lactis B9Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. lactis subsp. lactis B12Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. lactis subsp. lactis K5Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. lactis subsp. lactis K6Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. lactis subsp. lactis K7Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. paracasei LP33Fermented milkCommercial probiotic
Lactobacillus paracasei ChamytoYogurtIdentified by phenotypic characterization and sequence analysis of 16S rDNA
L. paracasei subsp. paracasei ATCC11974Dental carries-
L. paracasei subsp. paracasei NCIMB8001--
L. rhamnusus NCIMB6375Oral
L. rhamnusus GGHuman fecesCommercial probiotic
L. rhamnosus NCIMB 8690--
Leuconostoc mesentroides K13Fermented milkIdentified by phenotypic characterization and sequence analysis of 16S rDNA
Streptococcus thermophilus NCIMB10387YogurtCommercial probiotic
Table 2 PCR Primers and the annealing temperatures used for PCRs
Gene nameForwardReverseAnnealing temp (°C)Length (bp)
β-actinGGCGACGAGGCCCAGAGCAAGAGAGGCATCGATTTCCCGCTCGGCCGTGGTGGTGAAGC55460
IL-4AACACAACTGAGAAGGAAACCTTCGCTCGAACACTTTGAATATTTCTC55276
IL-8ATGACTTCCAAGCTGGCCGTGGCTTCTCAGCCCTCTTCAAAAACTTCTC55289
IL-10ATGCCCCAAGCTGAGAACCAAGACCCATCTCAAGGGGCTGGGTCAGCTATCCCA55352
TGF-βTGACAGCAGGGATAACACACTGTAGGGGCAGGGCCCGAGGCA55288
TLR1CTATACACCAAGTTGTCAGCGTCTCCAACTCAGTAAGGTG55219
TLR2GCCAAAGTCTTGATTGATTGGTTGAAGTTCTCCAGCTCCTG55346
TLR3GATCTGTCTCATAATGGCTTGGACAGATTCCGAATGCTTGTG55304
TLR4CTTTATCCAACCAGGTGCGGAATGCTGGAAATCCAG50650
TLR5TAGCTCCTAATCTGATGCCATGTGAAGTCTTTGCTGC50437
TLR9GTCCCCACTTCTCCATGGGCACAGTCATGATGTTGTTG55259
TNF-αCAGAGGGAAGAGTTCCCCAGCCTTGGTCTGGTAGGAGACG55324
TollipCGCGGTACCGCCACCATGGCGACCACCGTCAGCGCCGGGCCCTGGCTCCTCCCCCATCTG60850
TRAF6GTCGGTACCGCCACCATGAGTCTGCTAAACTGTGAACGCGGGCCCCTATACCCCTGCATCAGTAC601600
Table 3 TLRs regulation in IECs upon the treatment of LAB
TLR1TLR3TLR4TLR5TLR9TRAF6TOLLIP
HCT116NESNENESSNC
Caco-2NENCNCNESNCNC
HT-29NENCSNENCSNC
Table 4 Adhesion scores of E. faecalis after carbohydrate oxidation
Bacterial StrainsAdhesion score1
% change
Whole cell bacteriam-periodate treated bacteria
E. faecalis EC11118.1286-74.42
E. faecalis EC31608328-79.6
E. faecalis EC151794442.2-75.35
E. faecalis EC16693282-59.31
S. typhimurium24940-18.37
L. rhamnosus GG60585040.5


Write to the Help Desk