©2008 The WJG Press and Baishideng.
World J Gastroenterol. Feb 14, 2008; 14(6): 925-930
Published online Feb 14, 2008. doi: 10.3748/wjg.14.925
Published online Feb 14, 2008. doi: 10.3748/wjg.14.925
Table 1 Sequences of human primers used for real-time PCR experiments
| Target mRNA | Primer sequence (5’-3’) | Accession number | Size (bp) |
| ABCB1 | 5′AGGTTCCAGGATTGGCGTCTT3′ | AF399931 | 156 |
| 5′CCAGTCATTGCTGCGGTTTCA3′ | 1152-1307 | ||
| ABCG2 | 5′AATACATCAGCGGATACTACAGAG3′ | AY333756 | 179 |
| 5′AGCCACCATCATAAGGGTAAACAT3′ | 1382-1560 | ||
| β-actin | 5’GAACGGTGAAGGTGACAG3’ | NM_001101 | 293 |
| 5’TAGAGAGAGTGGGGTGG3’ | 915-1207 |
Table 2 Relative quantitation of mRNA using the 2-ΔΔCT method
| Target mRNA | ΔCT | Target mRNA | |
| (Target mRNA-β-actin) | related toβ-actin | ||
| non-SP cells | ABCB1 | 5.82 ± 1.16 | 0.0176 |
| (0.0079-0.0393) | |||
| ABCG2 | 5.48 ± 0.94 | 0.0224 | |
| (0.0116-0.0432) | |||
| SP cells | ABCB1 | 1.15 ± 0.72 | 0.4504 |
| (0.2731-0.7431) | |||
| ABCG2 | 1.16 ± 0.75 | 0.4483 | |
| (0.2662-0.7547) |
- Citation: Zhou J, Wang CY, Liu T, Wu B, Zhou F, Xiong JX, Wu HS, Tao J, Zhao G, Yang M, Gou SM. Persistence of side population cells with high drug efflux capacity in pancreatic cancer. World J Gastroenterol 2008; 14(6): 925-930
- URL: https://www.wjgnet.com/1007-9327/full/v14/i6/925.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.925
