BPG is committed to discovery and dissemination of knowledge
Gastric Cancer
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Feb 7, 2008; 14(5): 693-700
Published online Feb 7, 2008. doi: 10.3748/wjg.14.693
Table 1 Xenograft tumor weight in nude mice after different treatments
GroupTest 1
Test 2
Test 3
Number Begin/EndTumor weight (g)P valueInhibition rate (%)Number Begin/EndTumor weight (g)P valueInhibition rate (%)Number Begin/EndTumor weight (g)P valueInhibition rate (%)
WCA8/80.99 ± 0.760.0117a48.78/721.02 ± 0.160.0045b37.918/80.88 ± 0.470.0072b46.35
5-FU10/910.77 ± 0.480.0002b60.17/70.97 ± 0.340.0056b41.297/70.98 ± 0.460.0167a39.74
Control8/81.93 ± 0.588/81.65 ± 0.469/91.63 ± 0.52
Table 2 WCA-induced effects on gastric cancer cell SGC-7901
GroupnPCNA
TUNEL
Cleaved caspase-3 (Asp 175) (%)
Positive rate (%)P valueIntense positive rate (%)P valueTotal positive rate (%)P valueApoptotic index (%)P valuePositive rate (%)P value
WCA835.73 ± 6.010.0005b3.39 ± 1.480.0155a39.03 ± 7.370.0009b9.72 ± 4.510.0007b5.20 ± 2.260.0367a
5-FU937.86 ± 16.500.0325a5.62 ± 4.210.197243.48 ± 19.770.0406a5.74 ± 1.750.0007b4.73 ± 1.760.0451a
Control853.48 ± 9.348.78 ± 5.4362.26 ± 13.802.45 ± 1.372.82 ± 1.84
Table 3 Quantification of gene expression by real-time quantitative PCR assay
Gene nameUniGene clusterPrimer sequences (5’-3’)Combining sites (bp)Amplifiers (bp)WCA (120 mg/mL) vs NS control
ΔΔCT (n)2-ΔΔCT
stat3Hs.421342forwardCCTGGAGCAGCTCCATCAG254582.65 (4)0.16 (0.11-0.24)
reverseAAACTGCCGCAGCTCCATT311
RIPXHs.7927forwardGAGTGCCTTTAAGCTGCAGAGTT6692.50 (5)0.18 (0.13-0.23)
reverseTCCAAGCGACTGTTTAGTTCACTT74
ROD1Hs.269988forwardAACTCCTCTCTGTAAAGCATTTTGC525642.09 (4)0.23 (0.12-0.23)
reverseTGCACTGGGTCTTCTTTCAGAA588
bcl-2Hs.12677forwardTGTTGGCCGGATCACCAT2557603.27 (5)0.10 (0.06-0.17)
reverseTCCCCAATGATCAGGTCCTTT2616
Table 4 Xenograft gastric cancer cell SGC-7901 P-Stat3 and Bcl-2 expression after different treatments
GroupnP-Stat3
Bcl-2
Positive rate (%)P valueIntense positive rate (%)P valueTotal positive rate (%)P valuePositive rate (%)P value
WCA835.93 ± 12.670.0024b3.64 ± 1.720.0023b39.57 ± 13.310.0002b1.62 ± 0.820.0006b
5-FU936.95 ± 27.210.07324.38 ± 3.620.0050b41.33 ± 30.220.0243a7.72 ± 5.310.9364
Control856.49 ± 9.3413.16 ± 7.0669.65 ± 10.807.53 ± 3.73