©2008 The WJG Press and Baishideng.
World J Gastroenterol. Nov 7, 2008; 14(41): 6355-6359
Published online Nov 7, 2008. doi: 10.3748/wjg.14.6355
Published online Nov 7, 2008. doi: 10.3748/wjg.14.6355
Table 1 Primers used in the present study. The hepatocyte specific gene expression levels were determined by using RT-PCR method. As hepatocyte specific parameters, albumin and CYP3A2 were selected. As an internal control, GAPDH gene expression was also examined. The primer sequences and optimal PCR conditions were summarized
| Gene | Sequence (5’-3’ sense/antisense) | Reaction condition | Product size | Cycles | ||
| Denaturation | Annealing | Elongation | ||||
| GAPDH | TTCAACGGCACAGTCAAG | 95°C, 1 min | 60°C, 1 min | 72°C, 2 min | 240 bp | 26 |
| CACACCCATCACAAACAT | ||||||
| CYP3A2 | TACTACAAGGGCTTAGGGAG | 94°C, 1 min | 60°C, 1 min | 72°C, 2 min | 348 bp | 27 |
| CTTGCCTGTCTCCGCCTCTT | ||||||
| ALB | ATACACCCAGAAAGCACCTC | 94°C, 1 min | 60°C, 1 min | 72°C, 2 min | 305 bp | 27 |
| CAGAGTGGAAGGTGAAGGTC | ||||||
- Citation: Nagayoshi S, Kawashita Y, Eguchi S, Kamohara Y, Takatsuki M, Miyamoto S, Mochizuki S, Soyama A, Tokai H, Hidaka M, Tajima Y, Kanematsu T. Metabolism for cyclosporin A during liver regeneration after partial hepatectomy in rats. World J Gastroenterol 2008; 14(41): 6355-6359
- URL: https://www.wjgnet.com/1007-9327/full/v14/i41/6355.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.6355
