Metabolism for cyclosporin A during liver regeneration after partial hepatectomy in rats

Table 1 Primers used in the present study. The hepatocyte specific gene expression levels were determined by using RT-PCR method. As hepatocyte specific parameters, albumin and CYP3A2 were selected. As an internal control, GAPDH gene expression was also examined. The primer sequences and optimal PCR conditions were summarized

Gene	Sequence (5’-3’ sense/antisense)	Reaction condition			Product size	Cycles
		Denaturation	Annealing	Elongation
GAPDH	TTCAACGGCACAGTCAAG	95°C, 1 min	60°C, 1 min	72°C, 2 min	240 bp	26
	CACACCCATCACAAACAT
CYP3A2	TACTACAAGGGCTTAGGGAG	94°C, 1 min	60°C, 1 min	72°C, 2 min	348 bp	27
	CTTGCCTGTCTCCGCCTCTT
ALB	ATACACCCAGAAAGCACCTC	94°C, 1 min	60°C, 1 min	72°C, 2 min	305 bp	27
	CAGAGTGGAAGGTGAAGGTC