Gene modulation associated with inhibition of liver regeneration in hepatitis B virus X transgenic mice

Table 1 Primer’s sequence and PCR conditions used for the microarray results validation

Name of gene	Sequences of forward (F) and reverse (R) primers	Source of primers	PCR product (bp)	T anneling (°C)	Mg2+ (mmol/L)
Serum amyloid A3	F: TCAGCACATTGGGATGTTTAGG	UniSTS: 219434	206	53	3
	R: CAGAGGACTCAAGAGCTGACCA
Creatine kinase muscle	F: CCTCCTGGAAGTCCAATCAT	UniSTS: 159603	150	53	3
	R: GGCCATCACGGACTTTTATT
Peroxiredoxin 1	F: GAGCAGCCAGAAGAAACTCTTG	UniSTS: 144118	153	53	3
	R: AGAAGATTGGTCTGCCCAAAA
Retinoblastoma-like 2	F: TGGCTGAGTCCTGTAACAAC	UniSTS: 162222	374	53	2
	R: CCAACACCTTTCTGAGGC
Interleukin-6-receptor, 80-kD	F: AAGCAGCAGGCAATGTTACC	[18]	120	55	3
	R: CATAAATAGTTCCCAGTGTCG
DNA mismatch repair protein MSH6	F: ATATGTCCTAGGCGCACACAAA	UniSTS: 211063	208	56	4
	R: CTAGCATACTCAGGCATGCGAC
Peroxisome proliferator-activated receptor-α	F: CATCGAGTGTCGAATATGTGG	[19]	172	55	4
	R: GCAGTACTGGCATTTGTTCC
β-actin	F: CGTGACATTAAGGAGAAGCTGTGC	[20]	374	53	2
	R: CTCAGGAGGAGCAATGATCTTGAT

MSH6: DNA mismatch repair protein 6.

Table 2 Upregulated genes in HBx-LacZ transgenic mice 48 h after partial hepatectomy

Gene name (Abbreviation)	Unigene ID	GB Acc.	Fold difference HBx-LacZ/LacZ	P value	Function
Aven: caspase activation inhibitor	Mm.292041	BF662037	1.50	0.030	Caspase inhibitor
RAD52 homolog	Mm.149	U12135	2.14	0.035	DNA repair/double-strand break
Mismatch repair protein MSH6	Rn.16755	XM345633	1.51	0.009	DNA repair/mismatch
Epidermal growth factor	Rn.6075	NM012842	1.40	0.014	Growth factor
DC-SING (CD209)	Mm.32510	NM133238	1.40	0.009	Transmembrane protein/Cell adhesion
Leucyl-tRNA synthetase	Hs.432674	NM020117	1.41	0.009	Metabolism/protein synthesis
Syndecan 4	Mm.3815	BC005679	1.42	0.014	Transmembrane protein/Focal adhesion
Transmembrane 4 superfamily member	Mm.18590	BC050153	1.45	0.009	Tetraspanin interacting with beta-1 integrin
Golgi SNAP receptor complex member 2	Rn.13518	BC061994	1.42	0.011	Transmembrane protein/Vesicular transport of Golgi

Abbreviations: RAD52: DNA double-strand break repair and recombination protein; DC-SING: Dendritic Cells-specific intercellular adhesion molecule 3-grabbing nonintegrin.

Table 3 Downregulated genes in HBx-LacZ transgenic mice 48 h after partial hepatectomy

Gene name (Abbreviation)	Unigene ID	GB Acc.	Fold difference HBx-LacZ/LacZ	P value	Function
Serum amyloid A3 (Saa3)	Mm.14277	X03479	-1.95	0.016	Acute phase response protein cholesterol transport
Cadherin 16 (Cdh 16)	Mm.19423	AF016271	-2.64	0.010	cell recognition protein
Creatine kinase (Ckm)	Mm.2375	AI325205	-1.65	0.040	ATP synthesis
Glutathione S-transferase, pi2 (Gstp2)	Mm.299292	AI325120	-1.85	0.043	Detoxification and drug metabolism
Progastricsin ( pepsinogen C) (Pgc)	Mm.22957	AK008959	-1.73	0.009	Digestion enzyme
Phospholipase A2 group 1B (Pla2g1b)	Mm.20190	AI327450	-1.58	0.016	Digestion enzyme
Tripsin II precursor (Try2)	Mm.301947	AI386046	-1.54	0.014	Digestion enzyme
Farnesyl diphosphate synthase (Fdps)	Mm.39472	W76783	-1.98	0.020	Enzyme of cholesterol pathway
Cytochrom P450, 7b1 (Cyp7b1)	Mm.278588	U36993	-1.61	0.009	Enzyme of cholesterol pathway
Geranylgeranyl diphosphate synthase 1 (Ggps 1)	Mm.148039	AB016044	-1.41	0.034	Enzyme of cholesterol pathway
Aldolase1, A isoform (Aldo 1)	Mm.275831	AI327494	-3.35	0.015	Enzyme of glycolysis pathway
Peptidylglycine alpha-amidating monooxygenase	Mm.5121	AI323455	-1.73	0.029	Posttranslational modification
Mouse integrase gene (IN)	NF	X52622	-1.43	0.021	Replication
Myogenic differentiation1 (MyoD1)	Mm.1526	M84918	-1.52	0.032	Transcription
Zinc finger protein 90 (Zfp 90)	Mm.295582	X79828	-2.06	0.040	Transcription
Histone deacetylase 10 (Hdac 10)	Mm.346413	AI323 456	-3.73	0.014	Transcription
Prion protein (Prnp)	Mm.648	M13685	-1.40	0.021	CNS protein

Table 4 Results from RT-real time PCR 48 h after PH for selected genes

Gene	Mice1	RT-real time PCR		Microarrays fold difference HBx-LacZ/LacZ
		Relative value2	Fold difference HBx-LacZ/LacZ
SAA3	LacZ	0.37 ± 0.41	-10.9	-2.00
	HBx-LacZ	0.03 ± 0.02
Creatine Kinase	LacZ	1.36 ± 1.29	-1.6	-1.65
	HBx-LacZ	0.87 ± 0.91
MSH6	LacZ	1.08 ± 0.64	1.5	1.50
	HBx-LacZ	1.62 ± 0.64
Rb2	LacZ	0.47 ± 0.15	1.2	1.20
	HBx-LacZ	0.59 ± 0.23
Peroxiredoxin	LacZ	0.08 ± 0.02	1.5	1.40
	HBx-LacZ	0.12 ± 0.08

SAA3: Serum Amyloid A3; MSH6: DNA mismatch repair protein 6; Rb2: Retinoblastoma like-2.

¹Four animals in control (LacZ) group and four animals in treated (HBx-LacZ) group;

²for each experiment relative values were obtained after normalization with beta actin expression.