BPG is committed to discovery and dissemination of knowledge
Colorectal Cancer
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Jan 28, 2008; 14(4): 524-531
Published online Jan 28, 2008. doi: 10.3748/wjg.14.524
Table 1 SFRP2 gene primer sequences, annealing temperature and product size for MethyLight assays
CpG statusForward primer (5’-3’)Reverse primer (5’-3’)Annealing temperature (°C)Product size (bp)
MGGGTCGGAGTTTTTCGGAGTTGCGCCCGCTCTCTTCGCTAAATACGACTCG62138
UTTTTGGGTTGGAGTTTTTTGGAGTTGTGTAACCCACTCTCTTCACTAAATACAACTCA50145
Table 2 Hypermethylation of SFRP2 in tissue and stool specimens taken from the same patients with colorectal cancer, adenoma, polyp and normal controls
CharacteristicsCase (n)Tissue M1 (%)χ2PFecal M2 (%)χ2PSensitivity M2/nSpecificity
Colorectal Cancer6963 (91.3)75.32610.000160 (87.0)57.58810.000187.00%
Age
< 502017 (85.0)1.4100.23516 (80.0)1.2020.273
≥ 504946 (93.9)44 (89.8)
Sex
Male3734 (91.9)0.0350.85232 (86.5)0.0160.901
Female3229 (90.6)28 (87.5)
TNM stage
I/II3027 (90.0)0.1140.73625 (83.3)0.6140.433
III/IV3936 (92.3)35 (89.7)
Lymph node status
Positive2725 (92.6)0.0930.76124 (88.9)0.1460.702
Negative4238 (90.5)36 (85.7)
Infiltration
Mucosa underlayer2118 (85.7)1.1880.27617 (81.0)0.9590.327
Muscular coat4845 (93.8)43 (89.6)
Tumor site
Rectum3027 (90.0)0.3060.85827 (90.0)0.4280.786
Left hemicolon1817 (94.4)15 (83.3)
Right hemicolon2119 (90.5)18 (85.7)
Adenoma3427 (79.4)27.57910.000121 (61.8)21.01610.000161.80%
Tubular adenoma118 (72.7)0.5180.7726 (54.5)0.5630.755
Villous adenoma108 (80.0)6 (60.0)
Tubulovillous adenoma1311 (84.6)9 (69.2)
Hyperplastic polyp2614 (53.8)21.53810.000111 (42.3)9.92610.002142.30%76.80%
Normal control3002 (6.7)