Copyright
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Jan 28, 2008; 14(4): 524-531
Published online Jan 28, 2008. doi: 10.3748/wjg.14.524
Published online Jan 28, 2008. doi: 10.3748/wjg.14.524
Table 1 SFRP2 gene primer sequences, annealing temperature and product size for MethyLight assays
| CpG status | Forward primer (5’-3’) | Reverse primer (5’-3’) | Annealing temperature (°C) | Product size (bp) |
| M | GGGTCGGAGTTTTTCGGAGTTGCGC | CCGCTCTCTTCGCTAAATACGACTCG | 62 | 138 |
| U | TTTTGGGTTGGAGTTTTTTGGAGTTGTGT | AACCCACTCTCTTCACTAAATACAACTCA | 50 | 145 |
Table 2 Hypermethylation of SFRP2 in tissue and stool specimens taken from the same patients with colorectal cancer, adenoma, polyp and normal controls
| Characteristics | Case (n) | Tissue M1 (%) | χ2 | P | Fecal M2 (%) | χ2 | P | Sensitivity M2/n | Specificity |
| Colorectal Cancer | 69 | 63 (91.3) | 75.3261 | 0.0001 | 60 (87.0) | 57.5881 | 0.0001 | 87.00% | |
| Age | |||||||||
| < 50 | 20 | 17 (85.0) | 1.410 | 0.235 | 16 (80.0) | 1.202 | 0.273 | ||
| ≥ 50 | 49 | 46 (93.9) | 44 (89.8) | ||||||
| Sex | |||||||||
| Male | 37 | 34 (91.9) | 0.035 | 0.852 | 32 (86.5) | 0.016 | 0.901 | ||
| Female | 32 | 29 (90.6) | 28 (87.5) | ||||||
| TNM stage | |||||||||
| I/II | 30 | 27 (90.0) | 0.114 | 0.736 | 25 (83.3) | 0.614 | 0.433 | ||
| III/IV | 39 | 36 (92.3) | 35 (89.7) | ||||||
| Lymph node status | |||||||||
| Positive | 27 | 25 (92.6) | 0.093 | 0.761 | 24 (88.9) | 0.146 | 0.702 | ||
| Negative | 42 | 38 (90.5) | 36 (85.7) | ||||||
| Infiltration | |||||||||
| Mucosa underlayer | 21 | 18 (85.7) | 1.188 | 0.276 | 17 (81.0) | 0.959 | 0.327 | ||
| Muscular coat | 48 | 45 (93.8) | 43 (89.6) | ||||||
| Tumor site | |||||||||
| Rectum | 30 | 27 (90.0) | 0.306 | 0.858 | 27 (90.0) | 0.428 | 0.786 | ||
| Left hemicolon | 18 | 17 (94.4) | 15 (83.3) | ||||||
| Right hemicolon | 21 | 19 (90.5) | 18 (85.7) | ||||||
| Adenoma | 34 | 27 (79.4) | 27.5791 | 0.0001 | 21 (61.8) | 21.0161 | 0.0001 | 61.80% | |
| Tubular adenoma | 11 | 8 (72.7) | 0.518 | 0.772 | 6 (54.5) | 0.563 | 0.755 | ||
| Villous adenoma | 10 | 8 (80.0) | 6 (60.0) | ||||||
| Tubulovillous adenoma | 13 | 11 (84.6) | 9 (69.2) | ||||||
| Hyperplastic polyp | 26 | 14 (53.8) | 21.5381 | 0.0001 | 11 (42.3) | 9.9261 | 0.0021 | 42.30% | 76.80% |
| Normal control | 30 | 0 | 2 (6.7) |
-
Citation: Wang DR, Tang D. Hypermethylated
SFRP2 gene in fecal DNA is a high potential biomarker for colorectal cancer noninvasive screening. World J Gastroenterol 2008; 14(4): 524-531 - URL: https://www.wjgnet.com/1007-9327/full/v14/i4/524.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.524
