Copyright
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Jun 28, 2008; 14(24): 3804-3811
Published online Jun 28, 2008. doi: 10.3748/wjg.14.3804
Published online Jun 28, 2008. doi: 10.3748/wjg.14.3804
Table 1 Primer sequence, length and annealing temperature of exons 5-8 in PTEN gene
Primer sequence | Primer length (bp) | Amplification fragment length (bp) | Annealing temperature (°C) | |
Exon-5F: | ACCTGTTAAGTTTGTATGCAAC | 22 | 379 | 52 |
R | TCCAGGAAGAGGAAAGGAAA | 20 | ||
Exon-6F: | CATAGCAATTTAGTGAAATAACT | 23 | 274 | 52 |
R | GATATGGTTAAGAAAACTGTTC | 22 | ||
Exon-7F: | TGACAGTTTGACAGTTAAAGG | 21 | 263 | 58 |
R | GGATATTTCTCCCAATGAAAG | 21 | ||
Exon-8F: | CTCAGATTGCCTTATAATAGTC | 22 | 558 | 52 |
R | TCTGTTACTTGCTACGTAAAC | 21 |
Table 2 PTEN protein expression in gastric cancer and paracancerous tissue samples and intensity distribution n (%)
Clinicopathological parameters | Cases | PTEN protein expression | P | |||
- | + | ++ | +++ | |||
Paracancerous | 53 | 0 (0.0) | 10 (18.9) | 18 (34.0) | 25 (47.2) | < 0.005 |
Gastric cancer | 53 | 18 (34.0) | 17 (32.1) | 15 (28.3) | 3 (5.7) | |
Differentiation extent | < 0.005 | |||||
Moderate and high differentiation | 26 | 4 (15.4) | 6 (23.1) | 10 (38.5) | 6 (23.1) | |
Low differentiation | 27 | 14 (51.9) | 8 (29.6) | 3 (11.1) | 2 (7.4) |
Table 3 Correlation between PTEN protein expression and clinicopathological parameters in gastric cancer patients
Clinicopathology parameters | Case (n) | PTEN protein expression (n) | Positive rate (%) | P | |
Negative | Positive | ||||
Tissues | |||||
Paracancerous | 53 | 0 | 53 | 100.0 | < 0.005 |
Gastric cancer | 53 | 18 | 35 | 66.0 | |
Gender | |||||
Male | 41 | 15 | 26 | 63.4 | |
Female | 12 | 3 | 9 | 66.7 | |
Age (yr) | |||||
≤ 60 | 14 | 5 | 9 | 64.3 | |
> 60 | 39 | 13 | 26 | 66.7 | |
Size (cm) | |||||
≤ 3 | 16 | 6 | 10 | 68.8 | |
> 3 | 37 | 12 | 25 | 64.9 | |
Location | |||||
Antrum | 30 | 10 | 20 | 66.7 | |
Gastric body and cardia | 23 | 8 | 15 | 65.2 | |
Infiltrating depth | |||||
T1, T2 | 14 | 1 | 13 | 92.9 | < 0.025 |
T3 | 15 | 6 | 9 | 60.0 | |
T4 | 24 | 11 | 13 | 54.2 | |
Lymph node metastasis | |||||
Without | 21 | 2 | 19 | 90.5 | < 0.01 |
With | 32 | 16 | 16 | 50.0 | |
Distant metastasis | |||||
Without | 45 | 15 | 30 | 66.7 | |
With | 8 | 3 | 5 | 62.5 | |
Embolization | |||||
Without | 8 | 1 | 7 | 87.5 | |
With | 45 | 15 | 30 | 66.7 | |
Differentiation extent | |||||
Moderate and high | 26 | 4 | 22 | 84.6 | < 0.025 |
Low | 27 | 14 | 13 | 48.1 | |
PTNM staging | |||||
I, II | 19 | 1 | 18 | 94.7 | < 0.005 |
III, IV | 34 | 17 | 17 | 50.0 |
-
Citation: Guo CY, Xu XF, Wu JY, Liu SF. PCR-SSCP-DNA sequencing method in detecting
PTE N gene mutation and its significance in human gastric cancer. World J Gastroenterol 2008; 14(24): 3804-3811 - URL: https://www.wjgnet.com/1007-9327/full/v14/i24/3804.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.3804