©2008 The WJG Press and Baishideng.
World J Gastroenterol. May 21, 2008; 14(19): 3074-3080
Published online May 21, 2008. doi: 10.3748/wjg.14.3074
Published online May 21, 2008. doi: 10.3748/wjg.14.3074
Table 1 Clinicopathologic characteristics of patients with gastric and colorectal adenocarcinoma
| Characteristics | Patients (n) | ||
| Gastric cancer | Colorectal cancer | ||
| Sex | Male | 29 | 24 |
| Female | 18 | 21 | |
| Age (yr) | ≤ 60 | 21 | 31 |
| > 60 | 26 | 14 | |
| Differentiation grade | G1/Broders’ I | 2 | 4 |
| G2/Broders’ II | 23 | 34 | |
| G3/Broders’ III & IV | 22 | 7 | |
| Stage | TNM I/Duke’s A | 4 | 5 |
| TNM II/Duke’s B | 15 | 16 | |
| TNM III/Duke’s C | 16 | 14 | |
| TNM IV/Duke’s D | 12 | 10 | |
Table 2 Sequences of the primers used in MSP
| Primer | Sequence (5’-3’) | Amplicon location1 | Annealing temperature | Product size (bp) |
| MF | GGGTTTTGCGAGAGCGCG | 17 882-18 050 | 64°C | 169 |
| MR | GCTAACAAACGCGAACCG | |||
| UF | GGTTTTGTGAGAGTGTGTTTAG | 17 883-18 051 | 59°C | 169 |
| UR | CACTAACAAACACAAACCAAAC |
Table 3 Correlation between serum RASSF1A gene promoter methylation status and clinicopathologic parameters in gastric and colorectal adenocarcinoma patients
| Clinicopathologic parameters | Gastric cancer | Colorectal cancer | |||||
| RASSF1A promoter status | P value | RASSF1A promoter status | P value | ||||
| M | U | M | U | ||||
| Sex | Male | 9 | 20 | 0.58071 | 7 | 17 | 0.96491 |
| Female | 7 | 11 | 6 | 15 | |||
| Age (yr) | ≤ 60 | 8 | 13 | 0.59821 | 8 | 23 | 0.50242 |
| > 60 | 8 | 18 | 5 | 9 | |||
| Differentiation grade | G1/Broders’ I | 0 | 2 | 0.22801 | 1 | 3 | 0.98301 |
| G2/Broders’ II | 6 | 17 | 10 | 24 | |||
| G3/Broders’ III & IV | 10 | 12 | 2 | 5 | |||
| Surgical resection | Yes | 7 | 20 | 0.22031 | 5 | 10 | 0.73252 |
| No | 9 | 11 | 8 | 22 | |||
| Distant metastasis | Yes | 7 | 5 | 0.07462 | 5 | 5 | 0.12372 |
| No | 9 | 26 | 8 | 27 | |||
| Serum CEA | Elevated | 7 | 7 | 0.23652 | 6 | 7 | 0.12322 |
| Normal | 3 | 10 | 3 | 14 | |||
-
Citation: Wang YC, Yu ZH, Liu C, Xu LZ, Yu W, Lu J, Zhu RM, Li GL, Xia XY, Wei XW, Ji HZ, Lu H, Gao Y, Gao WM, Chen LB. Detection of
RASSF1A promoter hypermethylation in serum from gastric and colorectal adenocarcinoma patients. World J Gastroenterol 2008; 14(19): 3074-3080 - URL: https://www.wjgnet.com/1007-9327/full/v14/i19/3074.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.3074
