BPG is committed to discovery and dissemination of knowledge
Rapid Communication
Copyright ©2008 The WJG Press and Baishideng.
World J Gastroenterol. May 14, 2008; 14(18): 2877-2881
Published online May 14, 2008. doi: 10.3748/wjg.14.2877
Table 1 Primers of different quasispecies core proteins of HCV genotype 1b
Primer up (location)Primer down (location)
T: 1-172CGCGCTAGCATGAGGCACGAATCC (1-14)CCGGAATTCGCAACCGGGCAG (505-516)
NT: 1-172CGCGCTAGCATGAGCACGAATCC (1-14)CCGGAATTCGGCAACCGGGCAGATTC (505-516)
C191: 1-172CGCGCTAGCATGAGCACAAATCC (1-14)CCGGAATTCGGCAACCGGGCAAATTC (505-516)
Table 2 Core proteins of different quasispecies of HCV genotype 1b inhibited Chang liver cell cycle by impairing G1 to S transition at 24 h after transfection
G0/G1 phaseS phaseG2/M phase
T67.53 ± 5.47a17.23 ± 4.21a15.25 ± 1.96
NT65.49 ± 5.98a18.56 ± 2.49a15.95 ± 2.59
C19166.72 ± 6.82a17.89 ± 2.54a15.38 ± 2.16
pEGFP-N159.76 ± 5.3324.33 ± 3.1615.93 ± 1.42
Table 3 Core proteins of different quasispecies of HCV genotype 1b inhibited Chang liver cell cycle by impairing G1 to S transition at 48 h after transfection
G0/G1 phaseS phaseG2/M phase
T68.23 ± 6.54a15.30 ± 3.12a16.46 ± 2.57
NT66.14 ± 5.33a16.38 ± 2.21a17.47 ± 3.74
C19166.41 ± 3.02a15.92 ± 2.93a16.99 ± 2.43
pEGFP-N158.72 ± 2.2325.69 ± 2.4115.62 ± 1.28
Table 4 Core proteins of different quasispecies of HCV genotype 1b inhibited Chang liver cell cycle by impairing G1 to S transition at 72 h after transfection
G0/G1 phaseS phaseG2/M phase
T68.45 ± 4.98a14.79 ± 3.76a16.75 ± 3.21
NT67.21 ± 5.47a16.17 ± 2.55a16.63 ± 2.95
C19166.77 ± 4.32a16.38 ± 2.11a16.86 ± 2.19
pEGFP-N156.97 ± 3.2927.48 ± 3.3715.54 ± 1.93