©2008 The WJG Press and Baishideng.
World J Gastroenterol. Apr 7, 2008; 14(13): 2055-2060
Published online Apr 7, 2008. doi: 10.3748/wjg.14.2055
Published online Apr 7, 2008. doi: 10.3748/wjg.14.2055
Table 1 Primer sets used in MSP
| Primer sets | Sense primer: 5’-3’ | Antisense primer: 5’-3’ | Size (bp) |
| p16-W | CAGAGGGTGGGGCGGACCGC | CGGGCCGCGGCCGTGG | 140 |
| p16-M | TTATTAGAGGGTGGGGCGGATCGC | GACCCCGAACCGCGACCGTAA | 150 |
| p16-U | TTATTAGAGGGTGGGGTGGATTGT | CAACCCCAAACCACAACCATAA | 151 |
Table 2 Results of methylation in tumoral tissue and corresponding serum
| Tissue (+) | Tissue (-) | |
| Serum (+) | 14 | 0 |
| Serum (-) | 9 | 29 |
Table 3 Clinicopathological features of p16 promoter hypermethylation
| Variable | n (%) | Methylated | Unmethylated | P value |
| Total | 23 | 29 | ||
| Gender | ||||
| Male | 38 (73.1) | 17 | 21 | 0.904 |
| Female | 14 (26.9) | 6 | 8 | |
| Age (yr) | ||||
| < 64 | 26 (50.0) | 8 | 18 | 0.051 |
| > 64 | 26 (50.0) | 15 | 11 | |
| Pathological grade | ||||
| 1 | 20 (39.2) | 5 | 15 | < 0.05 |
| 2 | 11 (21.6) | 7 | 4 | |
| 3 | 20 (39.2) | 10 | 10 | (1 vs 2&3) |
| Pathological type | ||||
| Intestinal | 27 (62.7) | 13 | 14 | 0.754 (Intestinal vs Diffuse) |
| Diffuse | 14 (27.5) | 5 | 9 | 0.161 (Intestinal vs Mix) |
| Mixed | 5 (9.8) | 4 | 1 | 0.140 (Diffuse vs Mix) |
| Anatomical site | ||||
| Cardia | 22 (44.0) | 7 | 15 | 0.124 |
| Body | 15 (30.0) | 9 | 6 | |
| Pylorus | 13 (26.0) | 6 | 7 | (Cardia vs Noncardia) |
| Distant metastasis | ||||
| Absent | 39 (75.0) | 20 | 19 | 0.259 |
| Present | 13 (25.0) | 9 | 4 | |
| Smoking | ||||
| Yes | 9 (17.6) | 4 | 5 | 1.000 |
| No | 42 (82.4) | 19 | 23 | |
| H pylori infection | ||||
| Positive | 30 (60.0) | 11 | 19 | 0.201 |
| Negative | 20 (40.0) | 11 | 9 | |
Table 4 Results of methylation analysis in p16-positive and negative cases
| Immunohistochemistry | Methylated | Unmethylated |
| p16-positive | 3 | 17 |
| p16-negative | 20 | 12 |
-
Citation: Abbaszadegan MR, Moaven O, Sima HR, Ghafarzadegan K, A'rabi A, Forghani MN, Raziee HR, Mashhadinejad A, Jafarzadeh M, Esmaili-Shandiz E, Dadkhah E.
p16 promoter hypermethylation: A useful serum marker for early detection of gastric cancer. World J Gastroenterol 2008; 14(13): 2055-2060 - URL: https://www.wjgnet.com/1007-9327/full/v14/i13/2055.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.2055
