KIT exon 11 codon 557/558 deletion/insertion mutations define a subset of gastrointestinal stromal tumors with malignant potential

Table 1 Primer sequences used for KIT and PDGFRA PCR

Kit exon 9F tttggaaagctagtggttca	Kit exon 9R atggtagacagagcctaaac
Kit exon11F ctatttttccctttctcccc	Kit exon11R tacccaaaaaggtgacatgg
Kit exon 13F cttgacatcagtttgccag	Kit exon 13R aaaggcagcttggacacggcttta
Kit exon 17F tttctcctccaacctaatag	Kit exon 17R cctttgcaggactgtcaagc
PDGFRA exon 12aF ccagttacctgtcctggtcat	PDGFRA exon 12aR tggaaactcccatcttgagtc
PDGFRA exon 12bF aaattcgctggagggtcatt	PDGFRA exon 12bR ggaggttaccccatggaagt
PDGFR exon 18F agtgtgtccaccgtgatctg	PDGFRA exon 18R gtgtgggaagtgtggaggta

Table 2 Clinicopathological and molecular characteristics of GIST patients

Case No.	Sex	Age	Site	Size (cm)	Mitoses (/50 HPF)	Differentiation	CD117	Diagnosis	KIT mutations	PDGFRA mutations
1	F	72	LI	9	6	SP	N	Malignant potential	wt	wt
2	M	65	SI	2.8	10	M1	P	Malignant potential	p.A502-Y503insA	wt
3	M	79	S	16	9	EP	P	Malignant potential	p.K558>NP	wt
4	F	60	SI	17	3	EP	P	Malignant potential	p.K558>NP	wt
5	F	59	SI	5	2	SP	P	Low malignant potential	p.W557-K558del	wt
6	M	72	SI	7.8	2	SP	P	Malignant potential	p.W557-K558del	wt
7	M	82	S	5.5	5	SP	P	Very low malignant potential	p.D579del	wt
8	M	52	SI	4	3	SP	P	Low malignant potential	p.V559A	wt
9	F	63	S	8	7	SP	P	Malignant potential	p.V559A	wt
10	F	70	SI	6	1	M1	P	Malignant potential	p.W557-K558del	wt
11	F	60	S	9	4	M1	P	Very low malignant potential	wt	p.D842V
12	M	61	S	13	2	M2	P	Low-moderate malignant potential	wt	p.I 843-D846del
13	M	64	S	9	3	SP	P	Very low malignant potential	wt	wt
14	F	70	S	1.5	1	SP	P	Benign	p.P551-Q556del	wt
15	M	66	S	10	20	SP	P	Malignant potential	wt	wt
16	M	60	SI	12	4	SP	P	Malignant potential	p.Y503-F504insAY	wt
17	F	62	SI	3.5	1	SP	P	Low malignant potential	pV560D	wt
18	M	56	SI	4	1	SP	P	Low malignant potential	p.K550-E554del	wt
19	F	67	S	19	22	M1	P	Malignant potential	p.K550-K558del	wt
20	F	46	S	19	10	EP	P	Malignant potential	wt	wt
21	F	61	S	3.5	3	SP	P	Very low malignant potential	wt	wt
22	M	57	LI	8	5	SP	P	Malignant potential	pV560D	wt
23	M	58	S	0.7	0	SP	P	Benign	p.V559-G565del	wt
24	M	60	S	7.5	3	M2	P	Very low malignant potential	wt	wt
25	M	67	S	8	1	M2	P	Very low malignant potential	wt	wt
26	M	72	S	5.5	1	SP	P	Very low malignant potential	p.Y503-F504insAY	wt
27	F	70	LI	17	9	SP	P	Malignant potential	p.W557-K558del	wt
28	M	61	LI	2.6	6	SP	P	Malignant potential	p.P551-K558del	wt
29	F	53	S	5	0	SP	N	Very low malignant potential	wt	wt
30	F	57	LI	2.5	0	SP	P	Low malignant potential	wt	wt

S: Stomach; SI: Small intestine; LI: Large intestine; SP: Spindle cell; EP: Epithelioid; M1: Mixed type 1; M2: Mixed type 2; P: Positive; N: Negative.

Table 3 Clinicopathological data of GIST patients according to the presence of codon 557/558 deletion/insertion mutations

Variable	Wt (%)	557/558 mutations (%)	Non 557/558 mutations (%)	P
Age (yr)	61.7	67.2	62.5	NS
Size (cm)	8.2	11.3	4.4	0.025
Mitoses
Low ( ≤ 5/50 HPF)	71.4	50	87.5	NS
Intermediate	21.4	37.5	12.5
5-10/50 HPF
High (> 10/50 HPF)	7.1	12.5
Differentiation
Epithelioid	7.1	25		NS
Spindle cell	57.1	50	100
Mixed type 1	14.3	25
Mixed type 2	21.4
Risk assessment
Benign			25	0.003
Very low malignant potential	57.1		12.5
Low malignant potential	7.1	12.5	37.5
Low moderate malignant potential	14.3
Malignant potential	21.4	87.5	25

Table 4 GIST phenotypes according to the presence and type of KIT mutations

	Differentiation
	Epithelioid (%)	Spindle cells (%)	Mixed type 1 (%)	Mixed type 2 (%)	P
KIT mutation
Positive	10.5	73.3	15.8		NS
Negative	9.1	54.5	9.1	27.3
Exon 9		66.7	33.3		NS
Exon 11	12.5	75	12.5
Insertions	100				0.03
Deletions		80.0	20.0
Substitutions			100

Table 5 Risk assessment according to the KIT/PDGFRA mutations

	Risk assessment
	Benign (%)	Very low malignant potential (%)	Low malignant potential (%)	Low moderate malignant potential (%)	Malignant (%)	P
KIT mutation
Positive	10.5	10.5	21.1		57.9	0.003
Negative		63.6	9.1	18.2	9.1
Exon 9		33.3			66.7	0.036
Exon 11	12.5	6.3	25		56.3
PDGFRA mutation
Positive						NS
Negative		50		50