Copyright
©2008 The WJG Press and Baishideng.
World J Gastroenterol. Mar 28, 2008; 14(12): 1891-1897
Published online Mar 28, 2008. doi: 10.3748/wjg.14.1891
Published online Mar 28, 2008. doi: 10.3748/wjg.14.1891
Table 1 Primer sequences used for KIT and PDGFRA PCR
| Kit exon 9F tttggaaagctagtggttca | Kit exon 9R atggtagacagagcctaaac |
| Kit exon11F ctatttttccctttctcccc | Kit exon11R tacccaaaaaggtgacatgg |
| Kit exon 13F cttgacatcagtttgccag | Kit exon 13R aaaggcagcttggacacggcttta |
| Kit exon 17F tttctcctccaacctaatag | Kit exon 17R cctttgcaggactgtcaagc |
| PDGFRA exon 12aF ccagttacctgtcctggtcat | PDGFRA exon 12aR tggaaactcccatcttgagtc |
| PDGFRA exon 12bF aaattcgctggagggtcatt | PDGFRA exon 12bR ggaggttaccccatggaagt |
| PDGFR exon 18F agtgtgtccaccgtgatctg | PDGFRA exon 18R gtgtgggaagtgtggaggta |
Table 2 Clinicopathological and molecular characteristics of GIST patients
| Case No. | Sex | Age | Site | Size (cm) | Mitoses (/50 HPF) | Differentiation | CD117 | Diagnosis | KIT mutations | PDGFRA mutations |
| 1 | F | 72 | LI | 9 | 6 | SP | N | Malignant potential | wt | wt |
| 2 | M | 65 | SI | 2.8 | 10 | M1 | P | Malignant potential | p.A502-Y503insA | wt |
| 3 | M | 79 | S | 16 | 9 | EP | P | Malignant potential | p.K558>NP | wt |
| 4 | F | 60 | SI | 17 | 3 | EP | P | Malignant potential | p.K558>NP | wt |
| 5 | F | 59 | SI | 5 | 2 | SP | P | Low malignant potential | p.W557-K558del | wt |
| 6 | M | 72 | SI | 7.8 | 2 | SP | P | Malignant potential | p.W557-K558del | wt |
| 7 | M | 82 | S | 5.5 | 5 | SP | P | Very low malignant potential | p.D579del | wt |
| 8 | M | 52 | SI | 4 | 3 | SP | P | Low malignant potential | p.V559A | wt |
| 9 | F | 63 | S | 8 | 7 | SP | P | Malignant potential | p.V559A | wt |
| 10 | F | 70 | SI | 6 | 1 | M1 | P | Malignant potential | p.W557-K558del | wt |
| 11 | F | 60 | S | 9 | 4 | M1 | P | Very low malignant potential | wt | p.D842V |
| 12 | M | 61 | S | 13 | 2 | M2 | P | Low-moderate malignant potential | wt | p.I 843-D846del |
| 13 | M | 64 | S | 9 | 3 | SP | P | Very low malignant potential | wt | wt |
| 14 | F | 70 | S | 1.5 | 1 | SP | P | Benign | p.P551-Q556del | wt |
| 15 | M | 66 | S | 10 | 20 | SP | P | Malignant potential | wt | wt |
| 16 | M | 60 | SI | 12 | 4 | SP | P | Malignant potential | p.Y503-F504insAY | wt |
| 17 | F | 62 | SI | 3.5 | 1 | SP | P | Low malignant potential | pV560D | wt |
| 18 | M | 56 | SI | 4 | 1 | SP | P | Low malignant potential | p.K550-E554del | wt |
| 19 | F | 67 | S | 19 | 22 | M1 | P | Malignant potential | p.K550-K558del | wt |
| 20 | F | 46 | S | 19 | 10 | EP | P | Malignant potential | wt | wt |
| 21 | F | 61 | S | 3.5 | 3 | SP | P | Very low malignant potential | wt | wt |
| 22 | M | 57 | LI | 8 | 5 | SP | P | Malignant potential | pV560D | wt |
| 23 | M | 58 | S | 0.7 | 0 | SP | P | Benign | p.V559-G565del | wt |
| 24 | M | 60 | S | 7.5 | 3 | M2 | P | Very low malignant potential | wt | wt |
| 25 | M | 67 | S | 8 | 1 | M2 | P | Very low malignant potential | wt | wt |
| 26 | M | 72 | S | 5.5 | 1 | SP | P | Very low malignant potential | p.Y503-F504insAY | wt |
| 27 | F | 70 | LI | 17 | 9 | SP | P | Malignant potential | p.W557-K558del | wt |
| 28 | M | 61 | LI | 2.6 | 6 | SP | P | Malignant potential | p.P551-K558del | wt |
| 29 | F | 53 | S | 5 | 0 | SP | N | Very low malignant potential | wt | wt |
| 30 | F | 57 | LI | 2.5 | 0 | SP | P | Low malignant potential | wt | wt |
Table 3 Clinicopathological data of GIST patients according to the presence of codon 557/558 deletion/insertion mutations
| Variable | Wt (%) | 557/558 mutations (%) | Non 557/558 mutations (%) | P |
| Age (yr) | 61.7 | 67.2 | 62.5 | NS |
| Size (cm) | 8.2 | 11.3 | 4.4 | 0.025 |
| Mitoses | ||||
| Low ( ≤ 5/50 HPF) | 71.4 | 50 | 87.5 | NS |
| Intermediate | 21.4 | 37.5 | 12.5 | |
| 5-10/50 HPF | ||||
| High (> 10/50 HPF) | 7.1 | 12.5 | ||
| Differentiation | ||||
| Epithelioid | 7.1 | 25 | NS | |
| Spindle cell | 57.1 | 50 | 100 | |
| Mixed type 1 | 14.3 | 25 | ||
| Mixed type 2 | 21.4 | |||
| Risk assessment | ||||
| Benign | 25 | 0.003 | ||
| Very low malignant potential | 57.1 | 12.5 | ||
| Low malignant potential | 7.1 | 12.5 | 37.5 | |
| Low moderate malignant potential | 14.3 | |||
| Malignant potential | 21.4 | 87.5 | 25 |
Table 4 GIST phenotypes according to the presence and type of KIT mutations
| Differentiation | |||||
| Epithelioid (%) | Spindle cells (%) | Mixed type 1 (%) | Mixed type 2 (%) | P | |
| KIT mutation | |||||
| Positive | 10.5 | 73.3 | 15.8 | NS | |
| Negative | 9.1 | 54.5 | 9.1 | 27.3 | |
| Exon 9 | 66.7 | 33.3 | NS | ||
| Exon 11 | 12.5 | 75 | 12.5 | ||
| Insertions | 100 | 0.03 | |||
| Deletions | 80.0 | 20.0 | |||
| Substitutions | 100 | ||||
Table 5 Risk assessment according to the KIT/PDGFRA mutations
| Risk assessment | ||||||
| Benign (%) | Very low malignant potential (%) | Low malignant potential (%) | Low moderate malignant potential (%) | Malignant (%) | P | |
| KIT mutation | ||||||
| Positive | 10.5 | 10.5 | 21.1 | 57.9 | 0.003 | |
| Negative | 63.6 | 9.1 | 18.2 | 9.1 | ||
| Exon 9 | 33.3 | 66.7 | 0.036 | |||
| Exon 11 | 12.5 | 6.3 | 25 | 56.3 | ||
| PDGFRA mutation | ||||||
| Positive | NS | |||||
| Negative | 50 | 50 | ||||
- Citation: Kontogianni-Katsarou K, Dimitriadis E, Lariou C, Kairi-Vassilatou E, Pandis N, Kondi-Paphiti A. KIT exon 11 codon 557/558 deletion/insertion mutations define a subset of gastrointestinal stromal tumors with malignant potential. World J Gastroenterol 2008; 14(12): 1891-1897
- URL: https://www.wjgnet.com/1007-9327/full/v14/i12/1891.htm
- DOI: https://dx.doi.org/10.3748/wjg.14.1891
