©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 28, 2007; 13(8): 1195-1203
Published online Feb 28, 2007. doi: 10.3748/wjg.v13.i8.1195
Published online Feb 28, 2007. doi: 10.3748/wjg.v13.i8.1195
Table 1 Sequences of amplification and sequencing primers
| Forward primers | Positions nt | |
| E1 | 5' GAGGGGGCTGTGCAGTGGATG 3' | 6057-6077 |
| I3 | 5' TCCGGCTCGTGGCTAAGGGA 3' | 6246-6265 |
| S2 | 5' GGATTTCCACTACGTGACGGG 3' | 6620-6640 |
| S4 | 5' GGGTCTCCCCCCTCCTTGGCC 3' | 6906-6926 |
| S31 | 5' GGACTACGTCCCTCCGGTGG 3' | 7241-7260 |
| Reverse primers | ||
| AS2 | 5' CGTCACGTAGTGGAAATCCCC 3' | 6618-6638 |
| AS32 | 5' GGGACGTAGTCCGGGTCCTTC 3' | 7232-7252 |
| I4 | 5' GCAGCAGACGAGATCCTCAC 3' | 7567-7586 |
| E2 | 5' GCTGCGAGATGTTGTGGCGTA 3' | 7698-7718 |
| Cloning primers | (pMOS vector) | |
| SeqS1 | 5' GGGAAAGCTTGCATGCCTGC 3' | |
| SeqAS2 | 5' GACGTTGTAAAACGACGGCC 3' |
Table 2 Clinical and virological characteristics of the 10 patients studied before and during treatment mean ± SD
| Patient andtime of treatment | Sex | Age | Viral loadlog IU/mL | n | NT substitutions/mastersequence | AA substitutions/mastersequence | Genetic distance |
| SVR1-D0 | F | 48 | 2.00 | 15 | 4.5 ± 2.3 | 2.5 ± 1.4 | 0.0065 ± 0.0008 |
| SVR2-D0 | F | 53 | 4.55 | 13 | 5.1 ± 3.6 | 3.3 ± 2.1 | 0.0070 ± 0.0011 |
| SVR3-D0 | M | 43 | 4.71 | 8 | 10.3 ± 3.6 | 4.7 ± 1.9 | 0.0105 ± 0.0018 |
| SVR4-D0 | M | 59 | 6.24 | 16 | 15.4 ± 8.0 | 7.5 ± 4.9 | 0.0172 ± 0.0022 |
| SVR4-M3 | - | - | 1.61 | 13 | 3.6 ± 2.1 | 1.8 ± 1.0 | 0.0051 ± 0.0008 |
| SVR5-D0 | F | 65 | 5.44 | 15 | 10.1 ± 6.6 | 4.9 ± 2.0 | 0.0171 ± 0.0016 |
| SVR5-M3 | - | - | 2.77 | 17 | 6.4 ± 2.4 | 3.3 ± 1.6 | 0.0070 ± 0.0010 |
| SVR6-D0 | M | 47 | 7.26 | 17 | 15.9 ± 10.5 | 8.5 ± 5.1 | 0.0192 ± 0.0022 |
| SVR6-M3 | - | - | 2.18 | 6 | 4.0 ± 1.7 | 2.4 ± 1.3 | 0.0062 ± 0.0012 |
| SVR7-D0 | F | 51 | 6.61 | 15 | 29.3 ± 8.5 | 7.3 ± 2.7 | 0.0294 ± 0.0029 |
| SVR7-M3 | - | - | 5.42 | 15 | 12.6 ± 4.2 | 4.6 ± 2.2 | 0.0156 ± 0.0016 |
| NR1-D0 | M | 35 | 5.13 | 17 | 15.2 ± 4.3 | 3.5 ± 1.9 | 0.0181 ± 0.0020 |
| NR1-M3 | - | - | 5.24 | 9 | 15.3 ± 4.4 | 4.8 ± 1.7 | 0.0143 ± 0.0020 |
| NR1-M6 | - | - | 2.83 | 4 | 4.5 ± 3.1 | 2.0 ± 3.4 | 0.0041 ± 0.0013 |
| NR2-D0 | F | 50 | 5.90 | 17 | 15.6 ± 6.4 | 5.2 ± 2.9 | 0.0181 ± 0.0020 |
| NR2-M3 | - | - | 5.87 | 12 | 9.5 ± 3.6 | 3.9 ± 1.8 | 0.0125 ± 0.0013 |
| NR2-M6 | - | - | 5.77 | 10 | 10.3 ± 3.3 | 4.0 ± 2.2 | 0.0274 ± 0.0020 |
| NR3-D0 | F | 44 | 5.63 | 14 | 10.9 ± 3.7 | 4.4 ± 2.2 | 0.0279 ± 0.0021 |
| NR3-M3 | - | - | 5.79 | 11 | 11.1 ± 2.7 | 4.0 ± 2.8 | 0.0157 ± 0.0017 |
| NR3-M6 | - | - | 5.00 | 12 | 10.8 ± 3.3 | 4.4 ± 2.0 | 0.0154 ± 0.0015 |
Table 3 Characteristics of HCV quasispecies in pre-treatment isolates from SVR and NR patients
| Region andpatient type | Geneticdistance | dS | dN | dN/dS | Num. amino acidmutations |
| NS5A | |||||
| SVR (n = 99) | 0.1027 | 0.3239 | 0.039 | 0.120 | 33.9 |
| NR (n = 48) | 0.0698 | 0.1216 | 0.025 | 0.206 | 29.8 |
| ISDR | |||||
| SVR (n = 99) | 0.0834 | 0.3084 | 0.0295 | 0.096 | 1.3 |
| NR (n = 48) | 0.0765 | 0.2645 | 0.0271 | 0.102 | 1.9 |
| PKRbd | |||||
| SVR (n = 99) | 0.0934 | 0.2934 | 0.0424 | 0.145 | 5.3 |
| NR (n = 48) | 0.0815 | 0.2694 | 0.0332 | 0.123 | 5.7 |
| V3 | |||||
| SVR (n = 99) | 0.1836 | 0.3264 | 0.1282 | 0.393 | 6.0 |
| NR (n = 48) | 0.1372 | 0.4482 | 0.0556 | 0.124 | 4.7 |
Table 4 Complexity evolution in HCV quasispecies from SVR and NR patients in ISDR, PKRbd and V3 domains
| Patient | Time of treatmentdomains | D0ISDR-PKRbd-V3 | M3ISDR-PKRbd-V3 | M6ISDR-PKRbd-V3 |
| SVR1 | n = 15 | 3–4–3 | - | - |
| SVR2 | n = 13 | 3–4–2 | - | - |
| SVR3 | n = 8 | 3–5–3 | - | - |
| SVR4 | n = 16–13 | 3–7–3 | 3–4–3 | - |
| SVR5 | n = 15–17 | 8–8–1 | 4–7–1 | - |
| SVR6 | n = 17–6 | 8–9–3 | 1–2–3 | - |
| SVR7 | n = 15–17 | 6–6–7 | 6–7–7 | - |
| NR1 | n = 17–9–4 | 6–8–7 | 3–4–4 | 1–3–2 |
| NR2 | n = 17–12–10 | 7–8–2 | 5–8–3 | 3–4–6 |
| NR3 | n = 14–11–12 | 6–7–4 | 5–7–3 | 4–5–2 |
Table 5 Number of amino acids mutations observed in six different regions from NS5A protein, at baseline mean ± SD
| NS5A region (aa range) | 2 groups (D0)(n = 147) | SVR (D0)(n = 99) | NR (D0)(n = 48) | SVR (M3)(n = 51) | NR (M3)(n = 32) | NR (M6)(n = 26) |
| ISDR (2209-2248) | 1.5 ± 1.6 | 1.3 ± 1.7 | 1.9 ± 1.1 | 0.8 ± 0.8 | 2.1 ± 1.0 | 1.8 ± 1.2 |
| PKRbd (2209-2274) | 5.4 ± 2.1 | 5.3 ± 2.4 | 5.7 ± 1.2 | 4.7 ± 1.6 | 6.1 ± 1.0 | 5.7 ± 1.3 |
| V3 (2353-2379) | 5.5 ± 1.4 | 6.0 ± 1.5 | 4.7 ± 0.6 | 6.1 ± 1.3 | 4.8 ± 0.7 | 5.1 ± 0.6 |
| Complete NS5A (1973-2208) | 32.6 ± 5.6 | 33.9 ± 6.0 | 29.8 ± 3.7 | 31.7 ± 5.3 | 30.8 ± 3.9 | 31.9 ± 2.9 |
| N-terminal part of NS5A (1973-2208) | 12.4 ± 3.1 | 12.9 ± 3.3 | 11.6 ± 2.4 | 11.7 ± 2.0 | 11.2 ± 2.1 | 12.8 ± 2.1 |
| C-terminal part of NS5A (2209-2419) | 20.1 ± 3.9 | 21.1 ± 4.1 | 18.2 ± 2.4 | 20.1 ± 4.2 | 19.6 ± 2.9 | 19.4 ± 3.4 |
- Citation: Veillon P, Payan C, Le Guillou-Guillemette H, Gaudy C, Lunel F. Quasispecies evolution in NS5A region of hepatitis C virus genotype 1b during interferon or combined interferon-ribavirin therapy. World J Gastroenterol 2007; 13(8): 1195-1203
- URL: https://www.wjgnet.com/1007-9327/full/v13/i8/1195.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i8.1195